ID: 997671308

View in Genome Browser
Species Human (GRCh38)
Location 5:135675673-135675695
Sequence TTGGCTATTTAAGCTTTTAT CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997671306_997671308 7 Left 997671306 5:135675643-135675665 CCAGCTTTGTTTCTTTTGCTCAA No data
Right 997671308 5:135675673-135675695 TTGGCTATTTAAGCTTTTATCGG No data
997671305_997671308 10 Left 997671305 5:135675640-135675662 CCTCCAGCTTTGTTTCTTTTGCT 0: 10
1: 203
2: 5064
3: 16172
4: 8115
Right 997671308 5:135675673-135675695 TTGGCTATTTAAGCTTTTATCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997671308 Original CRISPR TTGGCTATTTAAGCTTTTAT CGG Intergenic
No off target data available for this crispr