ID: 997673729

View in Genome Browser
Species Human (GRCh38)
Location 5:135696856-135696878
Sequence GGGTATGAACTGAAGGAGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997673717_997673729 16 Left 997673717 5:135696817-135696839 CCTGCCAATCACTATGCCCAGTG No data
Right 997673729 5:135696856-135696878 GGGTATGAACTGAAGGAGCAGGG No data
997673722_997673729 0 Left 997673722 5:135696833-135696855 CCCAGTGCAGCCACAGGGGAGCT No data
Right 997673729 5:135696856-135696878 GGGTATGAACTGAAGGAGCAGGG No data
997673715_997673729 22 Left 997673715 5:135696811-135696833 CCACCTCCTGCCAATCACTATGC No data
Right 997673729 5:135696856-135696878 GGGTATGAACTGAAGGAGCAGGG No data
997673723_997673729 -1 Left 997673723 5:135696834-135696856 CCAGTGCAGCCACAGGGGAGCTG No data
Right 997673729 5:135696856-135696878 GGGTATGAACTGAAGGAGCAGGG No data
997673726_997673729 -10 Left 997673726 5:135696843-135696865 CCACAGGGGAGCTGGGTATGAAC No data
Right 997673729 5:135696856-135696878 GGGTATGAACTGAAGGAGCAGGG No data
997673716_997673729 19 Left 997673716 5:135696814-135696836 CCTCCTGCCAATCACTATGCCCA No data
Right 997673729 5:135696856-135696878 GGGTATGAACTGAAGGAGCAGGG No data
997673714_997673729 27 Left 997673714 5:135696806-135696828 CCTTTCCACCTCCTGCCAATCAC No data
Right 997673729 5:135696856-135696878 GGGTATGAACTGAAGGAGCAGGG No data
997673718_997673729 12 Left 997673718 5:135696821-135696843 CCAATCACTATGCCCAGTGCAGC No data
Right 997673729 5:135696856-135696878 GGGTATGAACTGAAGGAGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997673729 Original CRISPR GGGTATGAACTGAAGGAGCA GGG Intergenic
No off target data available for this crispr