ID: 997674215

View in Genome Browser
Species Human (GRCh38)
Location 5:135700780-135700802
Sequence CCATGTCTGCAGCTCTAGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997674209_997674215 -2 Left 997674209 5:135700759-135700781 CCTGGGCCTCTGCATGGCTCCCC No data
Right 997674215 5:135700780-135700802 CCATGTCTGCAGCTCTAGCAGGG No data
997674208_997674215 2 Left 997674208 5:135700755-135700777 CCTACCTGGGCCTCTGCATGGCT No data
Right 997674215 5:135700780-135700802 CCATGTCTGCAGCTCTAGCAGGG No data
997674202_997674215 20 Left 997674202 5:135700737-135700759 CCCCTCAGGCTCTGGGTGCCTAC No data
Right 997674215 5:135700780-135700802 CCATGTCTGCAGCTCTAGCAGGG No data
997674203_997674215 19 Left 997674203 5:135700738-135700760 CCCTCAGGCTCTGGGTGCCTACC No data
Right 997674215 5:135700780-135700802 CCATGTCTGCAGCTCTAGCAGGG No data
997674204_997674215 18 Left 997674204 5:135700739-135700761 CCTCAGGCTCTGGGTGCCTACCT No data
Right 997674215 5:135700780-135700802 CCATGTCTGCAGCTCTAGCAGGG No data
997674210_997674215 -8 Left 997674210 5:135700765-135700787 CCTCTGCATGGCTCCCCATGTCT No data
Right 997674215 5:135700780-135700802 CCATGTCTGCAGCTCTAGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997674215 Original CRISPR CCATGTCTGCAGCTCTAGCA GGG Intergenic
No off target data available for this crispr