ID: 997679317

View in Genome Browser
Species Human (GRCh38)
Location 5:135738209-135738231
Sequence ATCAAGTGCACTCATTCCCG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997679315_997679317 26 Left 997679315 5:135738160-135738182 CCTTGGGGAGTGAATCTTGAGCA No data
Right 997679317 5:135738209-135738231 ATCAAGTGCACTCATTCCCGTGG No data
997679314_997679317 27 Left 997679314 5:135738159-135738181 CCCTTGGGGAGTGAATCTTGAGC No data
Right 997679317 5:135738209-135738231 ATCAAGTGCACTCATTCCCGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997679317 Original CRISPR ATCAAGTGCACTCATTCCCG TGG Intergenic
No off target data available for this crispr