ID: 997679343

View in Genome Browser
Species Human (GRCh38)
Location 5:135738391-135738413
Sequence GTCCTGGTGTGGAGGAATTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997679343_997679357 30 Left 997679343 5:135738391-135738413 CCTGAATTCCTCCACACCAGGAC No data
Right 997679357 5:135738444-135738466 GAGGTGACATTTGCTGCAGAAGG No data
997679343_997679352 4 Left 997679343 5:135738391-135738413 CCTGAATTCCTCCACACCAGGAC No data
Right 997679352 5:135738418-135738440 GGGCCCGTGTTTGCAGCTGATGG No data
997679343_997679353 5 Left 997679343 5:135738391-135738413 CCTGAATTCCTCCACACCAGGAC No data
Right 997679353 5:135738419-135738441 GGCCCGTGTTTGCAGCTGATGGG No data
997679343_997679356 11 Left 997679343 5:135738391-135738413 CCTGAATTCCTCCACACCAGGAC No data
Right 997679356 5:135738425-135738447 TGTTTGCAGCTGATGGGAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997679343 Original CRISPR GTCCTGGTGTGGAGGAATTC AGG (reversed) Intergenic
No off target data available for this crispr