ID: 997679346

View in Genome Browser
Species Human (GRCh38)
Location 5:135738399-135738421
Sequence GCCCAGGGGTCCTGGTGTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997679346_997679352 -4 Left 997679346 5:135738399-135738421 CCTCCACACCAGGACCCCTGGGC No data
Right 997679352 5:135738418-135738440 GGGCCCGTGTTTGCAGCTGATGG No data
997679346_997679359 28 Left 997679346 5:135738399-135738421 CCTCCACACCAGGACCCCTGGGC No data
Right 997679359 5:135738450-135738472 ACATTTGCTGCAGAAGGTGGAGG No data
997679346_997679360 29 Left 997679346 5:135738399-135738421 CCTCCACACCAGGACCCCTGGGC No data
Right 997679360 5:135738451-135738473 CATTTGCTGCAGAAGGTGGAGGG No data
997679346_997679357 22 Left 997679346 5:135738399-135738421 CCTCCACACCAGGACCCCTGGGC No data
Right 997679357 5:135738444-135738466 GAGGTGACATTTGCTGCAGAAGG No data
997679346_997679356 3 Left 997679346 5:135738399-135738421 CCTCCACACCAGGACCCCTGGGC No data
Right 997679356 5:135738425-135738447 TGTTTGCAGCTGATGGGAAGAGG No data
997679346_997679353 -3 Left 997679346 5:135738399-135738421 CCTCCACACCAGGACCCCTGGGC No data
Right 997679353 5:135738419-135738441 GGCCCGTGTTTGCAGCTGATGGG No data
997679346_997679358 25 Left 997679346 5:135738399-135738421 CCTCCACACCAGGACCCCTGGGC No data
Right 997679358 5:135738447-135738469 GTGACATTTGCTGCAGAAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997679346 Original CRISPR GCCCAGGGGTCCTGGTGTGG AGG (reversed) Intergenic
No off target data available for this crispr