ID: 997679347

View in Genome Browser
Species Human (GRCh38)
Location 5:135738402-135738424
Sequence CGGGCCCAGGGGTCCTGGTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997679347_997679352 -7 Left 997679347 5:135738402-135738424 CCACACCAGGACCCCTGGGCCCG No data
Right 997679352 5:135738418-135738440 GGGCCCGTGTTTGCAGCTGATGG No data
997679347_997679358 22 Left 997679347 5:135738402-135738424 CCACACCAGGACCCCTGGGCCCG No data
Right 997679358 5:135738447-135738469 GTGACATTTGCTGCAGAAGGTGG No data
997679347_997679360 26 Left 997679347 5:135738402-135738424 CCACACCAGGACCCCTGGGCCCG No data
Right 997679360 5:135738451-135738473 CATTTGCTGCAGAAGGTGGAGGG No data
997679347_997679359 25 Left 997679347 5:135738402-135738424 CCACACCAGGACCCCTGGGCCCG No data
Right 997679359 5:135738450-135738472 ACATTTGCTGCAGAAGGTGGAGG No data
997679347_997679361 30 Left 997679347 5:135738402-135738424 CCACACCAGGACCCCTGGGCCCG No data
Right 997679361 5:135738455-135738477 TGCTGCAGAAGGTGGAGGGATGG No data
997679347_997679356 0 Left 997679347 5:135738402-135738424 CCACACCAGGACCCCTGGGCCCG No data
Right 997679356 5:135738425-135738447 TGTTTGCAGCTGATGGGAAGAGG No data
997679347_997679357 19 Left 997679347 5:135738402-135738424 CCACACCAGGACCCCTGGGCCCG No data
Right 997679357 5:135738444-135738466 GAGGTGACATTTGCTGCAGAAGG No data
997679347_997679353 -6 Left 997679347 5:135738402-135738424 CCACACCAGGACCCCTGGGCCCG No data
Right 997679353 5:135738419-135738441 GGCCCGTGTTTGCAGCTGATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997679347 Original CRISPR CGGGCCCAGGGGTCCTGGTG TGG (reversed) Intergenic
No off target data available for this crispr