ID: 997679348

View in Genome Browser
Species Human (GRCh38)
Location 5:135738407-135738429
Sequence AAACACGGGCCCAGGGGTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997679348_997679362 26 Left 997679348 5:135738407-135738429 CCAGGACCCCTGGGCCCGTGTTT No data
Right 997679362 5:135738456-135738478 GCTGCAGAAGGTGGAGGGATGGG No data
997679348_997679358 17 Left 997679348 5:135738407-135738429 CCAGGACCCCTGGGCCCGTGTTT No data
Right 997679358 5:135738447-135738469 GTGACATTTGCTGCAGAAGGTGG No data
997679348_997679357 14 Left 997679348 5:135738407-135738429 CCAGGACCCCTGGGCCCGTGTTT No data
Right 997679357 5:135738444-135738466 GAGGTGACATTTGCTGCAGAAGG No data
997679348_997679360 21 Left 997679348 5:135738407-135738429 CCAGGACCCCTGGGCCCGTGTTT No data
Right 997679360 5:135738451-135738473 CATTTGCTGCAGAAGGTGGAGGG No data
997679348_997679361 25 Left 997679348 5:135738407-135738429 CCAGGACCCCTGGGCCCGTGTTT No data
Right 997679361 5:135738455-135738477 TGCTGCAGAAGGTGGAGGGATGG No data
997679348_997679359 20 Left 997679348 5:135738407-135738429 CCAGGACCCCTGGGCCCGTGTTT No data
Right 997679359 5:135738450-135738472 ACATTTGCTGCAGAAGGTGGAGG No data
997679348_997679363 27 Left 997679348 5:135738407-135738429 CCAGGACCCCTGGGCCCGTGTTT No data
Right 997679363 5:135738457-135738479 CTGCAGAAGGTGGAGGGATGGGG No data
997679348_997679356 -5 Left 997679348 5:135738407-135738429 CCAGGACCCCTGGGCCCGTGTTT No data
Right 997679356 5:135738425-135738447 TGTTTGCAGCTGATGGGAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997679348 Original CRISPR AAACACGGGCCCAGGGGTCC TGG (reversed) Intergenic
No off target data available for this crispr