ID: 997679349

View in Genome Browser
Species Human (GRCh38)
Location 5:135738413-135738435
Sequence AGCTGCAAACACGGGCCCAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997679349_997679357 8 Left 997679349 5:135738413-135738435 CCCCTGGGCCCGTGTTTGCAGCT No data
Right 997679357 5:135738444-135738466 GAGGTGACATTTGCTGCAGAAGG No data
997679349_997679359 14 Left 997679349 5:135738413-135738435 CCCCTGGGCCCGTGTTTGCAGCT No data
Right 997679359 5:135738450-135738472 ACATTTGCTGCAGAAGGTGGAGG No data
997679349_997679358 11 Left 997679349 5:135738413-135738435 CCCCTGGGCCCGTGTTTGCAGCT No data
Right 997679358 5:135738447-135738469 GTGACATTTGCTGCAGAAGGTGG No data
997679349_997679360 15 Left 997679349 5:135738413-135738435 CCCCTGGGCCCGTGTTTGCAGCT No data
Right 997679360 5:135738451-135738473 CATTTGCTGCAGAAGGTGGAGGG No data
997679349_997679363 21 Left 997679349 5:135738413-135738435 CCCCTGGGCCCGTGTTTGCAGCT No data
Right 997679363 5:135738457-135738479 CTGCAGAAGGTGGAGGGATGGGG No data
997679349_997679362 20 Left 997679349 5:135738413-135738435 CCCCTGGGCCCGTGTTTGCAGCT No data
Right 997679362 5:135738456-135738478 GCTGCAGAAGGTGGAGGGATGGG No data
997679349_997679361 19 Left 997679349 5:135738413-135738435 CCCCTGGGCCCGTGTTTGCAGCT No data
Right 997679361 5:135738455-135738477 TGCTGCAGAAGGTGGAGGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997679349 Original CRISPR AGCTGCAAACACGGGCCCAG GGG (reversed) Intergenic
No off target data available for this crispr