ID: 997679351

View in Genome Browser
Species Human (GRCh38)
Location 5:135738415-135738437
Sequence TCAGCTGCAAACACGGGCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997679351_997679365 30 Left 997679351 5:135738415-135738437 CCTGGGCCCGTGTTTGCAGCTGA No data
Right 997679365 5:135738468-135738490 GGAGGGATGGGGATGCTACAGGG No data
997679351_997679363 19 Left 997679351 5:135738415-135738437 CCTGGGCCCGTGTTTGCAGCTGA No data
Right 997679363 5:135738457-135738479 CTGCAGAAGGTGGAGGGATGGGG No data
997679351_997679359 12 Left 997679351 5:135738415-135738437 CCTGGGCCCGTGTTTGCAGCTGA No data
Right 997679359 5:135738450-135738472 ACATTTGCTGCAGAAGGTGGAGG No data
997679351_997679358 9 Left 997679351 5:135738415-135738437 CCTGGGCCCGTGTTTGCAGCTGA No data
Right 997679358 5:135738447-135738469 GTGACATTTGCTGCAGAAGGTGG No data
997679351_997679361 17 Left 997679351 5:135738415-135738437 CCTGGGCCCGTGTTTGCAGCTGA No data
Right 997679361 5:135738455-135738477 TGCTGCAGAAGGTGGAGGGATGG No data
997679351_997679357 6 Left 997679351 5:135738415-135738437 CCTGGGCCCGTGTTTGCAGCTGA No data
Right 997679357 5:135738444-135738466 GAGGTGACATTTGCTGCAGAAGG No data
997679351_997679364 29 Left 997679351 5:135738415-135738437 CCTGGGCCCGTGTTTGCAGCTGA No data
Right 997679364 5:135738467-135738489 TGGAGGGATGGGGATGCTACAGG No data
997679351_997679362 18 Left 997679351 5:135738415-135738437 CCTGGGCCCGTGTTTGCAGCTGA No data
Right 997679362 5:135738456-135738478 GCTGCAGAAGGTGGAGGGATGGG No data
997679351_997679360 13 Left 997679351 5:135738415-135738437 CCTGGGCCCGTGTTTGCAGCTGA No data
Right 997679360 5:135738451-135738473 CATTTGCTGCAGAAGGTGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997679351 Original CRISPR TCAGCTGCAAACACGGGCCC AGG (reversed) Intergenic
No off target data available for this crispr