ID: 997679352

View in Genome Browser
Species Human (GRCh38)
Location 5:135738418-135738440
Sequence GGGCCCGTGTTTGCAGCTGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997679346_997679352 -4 Left 997679346 5:135738399-135738421 CCTCCACACCAGGACCCCTGGGC No data
Right 997679352 5:135738418-135738440 GGGCCCGTGTTTGCAGCTGATGG No data
997679343_997679352 4 Left 997679343 5:135738391-135738413 CCTGAATTCCTCCACACCAGGAC No data
Right 997679352 5:135738418-135738440 GGGCCCGTGTTTGCAGCTGATGG No data
997679347_997679352 -7 Left 997679347 5:135738402-135738424 CCACACCAGGACCCCTGGGCCCG No data
Right 997679352 5:135738418-135738440 GGGCCCGTGTTTGCAGCTGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997679352 Original CRISPR GGGCCCGTGTTTGCAGCTGA TGG Intergenic
No off target data available for this crispr