ID: 997679353

View in Genome Browser
Species Human (GRCh38)
Location 5:135738419-135738441
Sequence GGCCCGTGTTTGCAGCTGAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997679347_997679353 -6 Left 997679347 5:135738402-135738424 CCACACCAGGACCCCTGGGCCCG No data
Right 997679353 5:135738419-135738441 GGCCCGTGTTTGCAGCTGATGGG No data
997679343_997679353 5 Left 997679343 5:135738391-135738413 CCTGAATTCCTCCACACCAGGAC No data
Right 997679353 5:135738419-135738441 GGCCCGTGTTTGCAGCTGATGGG No data
997679346_997679353 -3 Left 997679346 5:135738399-135738421 CCTCCACACCAGGACCCCTGGGC No data
Right 997679353 5:135738419-135738441 GGCCCGTGTTTGCAGCTGATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997679353 Original CRISPR GGCCCGTGTTTGCAGCTGAT GGG Intergenic
No off target data available for this crispr