ID: 997679353 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 5:135738419-135738441 |
Sequence | GGCCCGTGTTTGCAGCTGAT GGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | No data | |||
Summary | No data |
Found 3 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
997679347_997679353 | -6 | Left | 997679347 | 5:135738402-135738424 | CCACACCAGGACCCCTGGGCCCG | No data | ||
Right | 997679353 | 5:135738419-135738441 | GGCCCGTGTTTGCAGCTGATGGG | No data | ||||
997679343_997679353 | 5 | Left | 997679343 | 5:135738391-135738413 | CCTGAATTCCTCCACACCAGGAC | No data | ||
Right | 997679353 | 5:135738419-135738441 | GGCCCGTGTTTGCAGCTGATGGG | No data | ||||
997679346_997679353 | -3 | Left | 997679346 | 5:135738399-135738421 | CCTCCACACCAGGACCCCTGGGC | No data | ||
Right | 997679353 | 5:135738419-135738441 | GGCCCGTGTTTGCAGCTGATGGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
997679353 | Original CRISPR | GGCCCGTGTTTGCAGCTGAT GGG | Intergenic | ||
No off target data available for this crispr |