ID: 997679356

View in Genome Browser
Species Human (GRCh38)
Location 5:135738425-135738447
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997679346_997679356 3 Left 997679346 5:135738399-135738421 CCTCCACACCAGGACCCCTGGGC No data
Right 997679356 5:135738425-135738447 TGTTTGCAGCTGATGGGAAGAGG No data
997679343_997679356 11 Left 997679343 5:135738391-135738413 CCTGAATTCCTCCACACCAGGAC No data
Right 997679356 5:135738425-135738447 TGTTTGCAGCTGATGGGAAGAGG No data
997679347_997679356 0 Left 997679347 5:135738402-135738424 CCACACCAGGACCCCTGGGCCCG No data
Right 997679356 5:135738425-135738447 TGTTTGCAGCTGATGGGAAGAGG No data
997679348_997679356 -5 Left 997679348 5:135738407-135738429 CCAGGACCCCTGGGCCCGTGTTT No data
Right 997679356 5:135738425-135738447 TGTTTGCAGCTGATGGGAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr