ID: 997679358

View in Genome Browser
Species Human (GRCh38)
Location 5:135738447-135738469
Sequence GTGACATTTGCTGCAGAAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997679348_997679358 17 Left 997679348 5:135738407-135738429 CCAGGACCCCTGGGCCCGTGTTT No data
Right 997679358 5:135738447-135738469 GTGACATTTGCTGCAGAAGGTGG No data
997679354_997679358 3 Left 997679354 5:135738421-135738443 CCCGTGTTTGCAGCTGATGGGAA No data
Right 997679358 5:135738447-135738469 GTGACATTTGCTGCAGAAGGTGG No data
997679350_997679358 10 Left 997679350 5:135738414-135738436 CCCTGGGCCCGTGTTTGCAGCTG No data
Right 997679358 5:135738447-135738469 GTGACATTTGCTGCAGAAGGTGG No data
997679349_997679358 11 Left 997679349 5:135738413-135738435 CCCCTGGGCCCGTGTTTGCAGCT No data
Right 997679358 5:135738447-135738469 GTGACATTTGCTGCAGAAGGTGG No data
997679347_997679358 22 Left 997679347 5:135738402-135738424 CCACACCAGGACCCCTGGGCCCG No data
Right 997679358 5:135738447-135738469 GTGACATTTGCTGCAGAAGGTGG No data
997679355_997679358 2 Left 997679355 5:135738422-135738444 CCGTGTTTGCAGCTGATGGGAAG No data
Right 997679358 5:135738447-135738469 GTGACATTTGCTGCAGAAGGTGG No data
997679351_997679358 9 Left 997679351 5:135738415-135738437 CCTGGGCCCGTGTTTGCAGCTGA No data
Right 997679358 5:135738447-135738469 GTGACATTTGCTGCAGAAGGTGG No data
997679346_997679358 25 Left 997679346 5:135738399-135738421 CCTCCACACCAGGACCCCTGGGC No data
Right 997679358 5:135738447-135738469 GTGACATTTGCTGCAGAAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997679358 Original CRISPR GTGACATTTGCTGCAGAAGG TGG Intergenic
No off target data available for this crispr