ID: 997679359

View in Genome Browser
Species Human (GRCh38)
Location 5:135738450-135738472
Sequence ACATTTGCTGCAGAAGGTGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997679347_997679359 25 Left 997679347 5:135738402-135738424 CCACACCAGGACCCCTGGGCCCG No data
Right 997679359 5:135738450-135738472 ACATTTGCTGCAGAAGGTGGAGG No data
997679349_997679359 14 Left 997679349 5:135738413-135738435 CCCCTGGGCCCGTGTTTGCAGCT No data
Right 997679359 5:135738450-135738472 ACATTTGCTGCAGAAGGTGGAGG No data
997679351_997679359 12 Left 997679351 5:135738415-135738437 CCTGGGCCCGTGTTTGCAGCTGA No data
Right 997679359 5:135738450-135738472 ACATTTGCTGCAGAAGGTGGAGG No data
997679354_997679359 6 Left 997679354 5:135738421-135738443 CCCGTGTTTGCAGCTGATGGGAA No data
Right 997679359 5:135738450-135738472 ACATTTGCTGCAGAAGGTGGAGG No data
997679350_997679359 13 Left 997679350 5:135738414-135738436 CCCTGGGCCCGTGTTTGCAGCTG No data
Right 997679359 5:135738450-135738472 ACATTTGCTGCAGAAGGTGGAGG No data
997679355_997679359 5 Left 997679355 5:135738422-135738444 CCGTGTTTGCAGCTGATGGGAAG No data
Right 997679359 5:135738450-135738472 ACATTTGCTGCAGAAGGTGGAGG No data
997679348_997679359 20 Left 997679348 5:135738407-135738429 CCAGGACCCCTGGGCCCGTGTTT No data
Right 997679359 5:135738450-135738472 ACATTTGCTGCAGAAGGTGGAGG No data
997679346_997679359 28 Left 997679346 5:135738399-135738421 CCTCCACACCAGGACCCCTGGGC No data
Right 997679359 5:135738450-135738472 ACATTTGCTGCAGAAGGTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997679359 Original CRISPR ACATTTGCTGCAGAAGGTGG AGG Intergenic
No off target data available for this crispr