ID: 997679360

View in Genome Browser
Species Human (GRCh38)
Location 5:135738451-135738473
Sequence CATTTGCTGCAGAAGGTGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997679350_997679360 14 Left 997679350 5:135738414-135738436 CCCTGGGCCCGTGTTTGCAGCTG No data
Right 997679360 5:135738451-135738473 CATTTGCTGCAGAAGGTGGAGGG No data
997679355_997679360 6 Left 997679355 5:135738422-135738444 CCGTGTTTGCAGCTGATGGGAAG No data
Right 997679360 5:135738451-135738473 CATTTGCTGCAGAAGGTGGAGGG No data
997679346_997679360 29 Left 997679346 5:135738399-135738421 CCTCCACACCAGGACCCCTGGGC No data
Right 997679360 5:135738451-135738473 CATTTGCTGCAGAAGGTGGAGGG No data
997679349_997679360 15 Left 997679349 5:135738413-135738435 CCCCTGGGCCCGTGTTTGCAGCT No data
Right 997679360 5:135738451-135738473 CATTTGCTGCAGAAGGTGGAGGG No data
997679354_997679360 7 Left 997679354 5:135738421-135738443 CCCGTGTTTGCAGCTGATGGGAA No data
Right 997679360 5:135738451-135738473 CATTTGCTGCAGAAGGTGGAGGG No data
997679351_997679360 13 Left 997679351 5:135738415-135738437 CCTGGGCCCGTGTTTGCAGCTGA No data
Right 997679360 5:135738451-135738473 CATTTGCTGCAGAAGGTGGAGGG No data
997679348_997679360 21 Left 997679348 5:135738407-135738429 CCAGGACCCCTGGGCCCGTGTTT No data
Right 997679360 5:135738451-135738473 CATTTGCTGCAGAAGGTGGAGGG No data
997679347_997679360 26 Left 997679347 5:135738402-135738424 CCACACCAGGACCCCTGGGCCCG No data
Right 997679360 5:135738451-135738473 CATTTGCTGCAGAAGGTGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997679360 Original CRISPR CATTTGCTGCAGAAGGTGGA GGG Intergenic
No off target data available for this crispr