ID: 997681081

View in Genome Browser
Species Human (GRCh38)
Location 5:135751116-135751138
Sequence CTAGTTCACCAGCCAGTGCA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997681081_997681084 13 Left 997681081 5:135751116-135751138 CCGTGCACTGGCTGGTGAACTAG No data
Right 997681084 5:135751152-135751174 GTTTGACACTGCTGAATTTGGGG No data
997681081_997681082 11 Left 997681081 5:135751116-135751138 CCGTGCACTGGCTGGTGAACTAG No data
Right 997681082 5:135751150-135751172 TTGTTTGACACTGCTGAATTTGG No data
997681081_997681083 12 Left 997681081 5:135751116-135751138 CCGTGCACTGGCTGGTGAACTAG No data
Right 997681083 5:135751151-135751173 TGTTTGACACTGCTGAATTTGGG No data
997681081_997681085 16 Left 997681081 5:135751116-135751138 CCGTGCACTGGCTGGTGAACTAG No data
Right 997681085 5:135751155-135751177 TGACACTGCTGAATTTGGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997681081 Original CRISPR CTAGTTCACCAGCCAGTGCA CGG (reversed) Intergenic
No off target data available for this crispr