ID: 997682324

View in Genome Browser
Species Human (GRCh38)
Location 5:135765239-135765261
Sequence GTGTACACACCCTGCGATGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997682324_997682335 17 Left 997682324 5:135765239-135765261 CCCACATCGCAGGGTGTGTACAC No data
Right 997682335 5:135765279-135765301 TGTGATATTCAGGGGTAAGAGGG No data
997682324_997682334 16 Left 997682324 5:135765239-135765261 CCCACATCGCAGGGTGTGTACAC No data
Right 997682334 5:135765278-135765300 TTGTGATATTCAGGGGTAAGAGG No data
997682324_997682333 9 Left 997682324 5:135765239-135765261 CCCACATCGCAGGGTGTGTACAC No data
Right 997682333 5:135765271-135765293 ATATGATTTGTGATATTCAGGGG No data
997682324_997682332 8 Left 997682324 5:135765239-135765261 CCCACATCGCAGGGTGTGTACAC No data
Right 997682332 5:135765270-135765292 GATATGATTTGTGATATTCAGGG No data
997682324_997682331 7 Left 997682324 5:135765239-135765261 CCCACATCGCAGGGTGTGTACAC No data
Right 997682331 5:135765269-135765291 TGATATGATTTGTGATATTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997682324 Original CRISPR GTGTACACACCCTGCGATGT GGG (reversed) Intergenic
No off target data available for this crispr