ID: 997682331

View in Genome Browser
Species Human (GRCh38)
Location 5:135765269-135765291
Sequence TGATATGATTTGTGATATTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997682324_997682331 7 Left 997682324 5:135765239-135765261 CCCACATCGCAGGGTGTGTACAC No data
Right 997682331 5:135765269-135765291 TGATATGATTTGTGATATTCAGG No data
997682323_997682331 8 Left 997682323 5:135765238-135765260 CCCCACATCGCAGGGTGTGTACA No data
Right 997682331 5:135765269-135765291 TGATATGATTTGTGATATTCAGG No data
997682325_997682331 6 Left 997682325 5:135765240-135765262 CCACATCGCAGGGTGTGTACACC No data
Right 997682331 5:135765269-135765291 TGATATGATTTGTGATATTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997682331 Original CRISPR TGATATGATTTGTGATATTC AGG Intergenic
No off target data available for this crispr