ID: 997682333

View in Genome Browser
Species Human (GRCh38)
Location 5:135765271-135765293
Sequence ATATGATTTGTGATATTCAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997682323_997682333 10 Left 997682323 5:135765238-135765260 CCCCACATCGCAGGGTGTGTACA No data
Right 997682333 5:135765271-135765293 ATATGATTTGTGATATTCAGGGG No data
997682325_997682333 8 Left 997682325 5:135765240-135765262 CCACATCGCAGGGTGTGTACACC No data
Right 997682333 5:135765271-135765293 ATATGATTTGTGATATTCAGGGG No data
997682324_997682333 9 Left 997682324 5:135765239-135765261 CCCACATCGCAGGGTGTGTACAC No data
Right 997682333 5:135765271-135765293 ATATGATTTGTGATATTCAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997682333 Original CRISPR ATATGATTTGTGATATTCAG GGG Intergenic
No off target data available for this crispr