ID: 997682335

View in Genome Browser
Species Human (GRCh38)
Location 5:135765279-135765301
Sequence TGTGATATTCAGGGGTAAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997682326_997682335 -5 Left 997682326 5:135765261-135765283 CCCCCCTGTGATATGATTTGTGA No data
Right 997682335 5:135765279-135765301 TGTGATATTCAGGGGTAAGAGGG No data
997682330_997682335 -9 Left 997682330 5:135765265-135765287 CCTGTGATATGATTTGTGATATT No data
Right 997682335 5:135765279-135765301 TGTGATATTCAGGGGTAAGAGGG No data
997682328_997682335 -7 Left 997682328 5:135765263-135765285 CCCCTGTGATATGATTTGTGATA No data
Right 997682335 5:135765279-135765301 TGTGATATTCAGGGGTAAGAGGG No data
997682323_997682335 18 Left 997682323 5:135765238-135765260 CCCCACATCGCAGGGTGTGTACA No data
Right 997682335 5:135765279-135765301 TGTGATATTCAGGGGTAAGAGGG No data
997682327_997682335 -6 Left 997682327 5:135765262-135765284 CCCCCTGTGATATGATTTGTGAT No data
Right 997682335 5:135765279-135765301 TGTGATATTCAGGGGTAAGAGGG No data
997682324_997682335 17 Left 997682324 5:135765239-135765261 CCCACATCGCAGGGTGTGTACAC No data
Right 997682335 5:135765279-135765301 TGTGATATTCAGGGGTAAGAGGG No data
997682329_997682335 -8 Left 997682329 5:135765264-135765286 CCCTGTGATATGATTTGTGATAT No data
Right 997682335 5:135765279-135765301 TGTGATATTCAGGGGTAAGAGGG No data
997682325_997682335 16 Left 997682325 5:135765240-135765262 CCACATCGCAGGGTGTGTACACC No data
Right 997682335 5:135765279-135765301 TGTGATATTCAGGGGTAAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997682335 Original CRISPR TGTGATATTCAGGGGTAAGA GGG Intergenic
No off target data available for this crispr