ID: 997682445

View in Genome Browser
Species Human (GRCh38)
Location 5:135765882-135765904
Sequence GCATACACCCTCCTGTGTTA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997682444_997682445 -9 Left 997682444 5:135765868-135765890 CCACATTGCAGGGGGCATACACC No data
Right 997682445 5:135765882-135765904 GCATACACCCTCCTGTGTTATGG No data
997682436_997682445 19 Left 997682436 5:135765840-135765862 CCCAGAAAGGAGAGGGGGATACT No data
Right 997682445 5:135765882-135765904 GCATACACCCTCCTGTGTTATGG No data
997682437_997682445 18 Left 997682437 5:135765841-135765863 CCAGAAAGGAGAGGGGGATACTA No data
Right 997682445 5:135765882-135765904 GCATACACCCTCCTGTGTTATGG No data
997682443_997682445 -8 Left 997682443 5:135765867-135765889 CCCACATTGCAGGGGGCATACAC No data
Right 997682445 5:135765882-135765904 GCATACACCCTCCTGTGTTATGG No data
997682442_997682445 -7 Left 997682442 5:135765866-135765888 CCCCACATTGCAGGGGGCATACA No data
Right 997682445 5:135765882-135765904 GCATACACCCTCCTGTGTTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997682445 Original CRISPR GCATACACCCTCCTGTGTTA TGG Intergenic
No off target data available for this crispr