ID: 997683666

View in Genome Browser
Species Human (GRCh38)
Location 5:135773823-135773845
Sequence TCTAATATCCAGAGGGGGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997683655_997683666 19 Left 997683655 5:135773781-135773803 CCCAATATCACAGGGGGTGTACA No data
Right 997683666 5:135773823-135773845 TCTAATATCCAGAGGGGGGAGGG No data
997683657_997683666 -4 Left 997683657 5:135773804-135773826 CCCTCCTTGTGATTTTGTTTCTA No data
Right 997683666 5:135773823-135773845 TCTAATATCCAGAGGGGGGAGGG No data
997683656_997683666 18 Left 997683656 5:135773782-135773804 CCAATATCACAGGGGGTGTACAC No data
Right 997683666 5:135773823-135773845 TCTAATATCCAGAGGGGGGAGGG No data
997683659_997683666 -8 Left 997683659 5:135773808-135773830 CCTTGTGATTTTGTTTCTAATAT No data
Right 997683666 5:135773823-135773845 TCTAATATCCAGAGGGGGGAGGG No data
997683658_997683666 -5 Left 997683658 5:135773805-135773827 CCTCCTTGTGATTTTGTTTCTAA No data
Right 997683666 5:135773823-135773845 TCTAATATCCAGAGGGGGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997683666 Original CRISPR TCTAATATCCAGAGGGGGGA GGG Intergenic
No off target data available for this crispr