ID: 997684841

View in Genome Browser
Species Human (GRCh38)
Location 5:135781305-135781327
Sequence CGTAATATGCAGAAGGGGTA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997684836_997684841 -7 Left 997684836 5:135781289-135781311 CCACTGTTATCTAAATCGTAATA No data
Right 997684841 5:135781305-135781327 CGTAATATGCAGAAGGGGTAGGG No data
997684832_997684841 17 Left 997684832 5:135781265-135781287 CCCATATTGCAGAAAGTGTACTC No data
Right 997684841 5:135781305-135781327 CGTAATATGCAGAAGGGGTAGGG No data
997684833_997684841 16 Left 997684833 5:135781266-135781288 CCATATTGCAGAAAGTGTACTCC No data
Right 997684841 5:135781305-135781327 CGTAATATGCAGAAGGGGTAGGG No data
997684834_997684841 -5 Left 997684834 5:135781287-135781309 CCCCACTGTTATCTAAATCGTAA No data
Right 997684841 5:135781305-135781327 CGTAATATGCAGAAGGGGTAGGG No data
997684835_997684841 -6 Left 997684835 5:135781288-135781310 CCCACTGTTATCTAAATCGTAAT No data
Right 997684841 5:135781305-135781327 CGTAATATGCAGAAGGGGTAGGG No data
997684831_997684841 18 Left 997684831 5:135781264-135781286 CCCCATATTGCAGAAAGTGTACT No data
Right 997684841 5:135781305-135781327 CGTAATATGCAGAAGGGGTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997684841 Original CRISPR CGTAATATGCAGAAGGGGTA GGG Intergenic
No off target data available for this crispr