ID: 997685687

View in Genome Browser
Species Human (GRCh38)
Location 5:135786185-135786207
Sequence TTTTACACCCCTGCCCCATG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997685687_997685690 -6 Left 997685687 5:135786185-135786207 CCCCATGGGGCAGGGGTGTAAAA No data
Right 997685690 5:135786202-135786224 GTAAAACCCTCCTTGCACCATGG No data
997685687_997685698 17 Left 997685687 5:135786185-135786207 CCCCATGGGGCAGGGGTGTAAAA No data
Right 997685698 5:135786225-135786247 ATCGTATATTCAGAGGGGAGAGG No data
997685687_997685699 18 Left 997685687 5:135786185-135786207 CCCCATGGGGCAGGGGTGTAAAA No data
Right 997685699 5:135786226-135786248 TCGTATATTCAGAGGGGAGAGGG No data
997685687_997685697 12 Left 997685687 5:135786185-135786207 CCCCATGGGGCAGGGGTGTAAAA No data
Right 997685697 5:135786220-135786242 CATGGATCGTATATTCAGAGGGG No data
997685687_997685694 10 Left 997685687 5:135786185-135786207 CCCCATGGGGCAGGGGTGTAAAA No data
Right 997685694 5:135786218-135786240 ACCATGGATCGTATATTCAGAGG No data
997685687_997685696 11 Left 997685687 5:135786185-135786207 CCCCATGGGGCAGGGGTGTAAAA No data
Right 997685696 5:135786219-135786241 CCATGGATCGTATATTCAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997685687 Original CRISPR TTTTACACCCCTGCCCCATG GGG (reversed) Intergenic
No off target data available for this crispr