ID: 997685688

View in Genome Browser
Species Human (GRCh38)
Location 5:135786186-135786208
Sequence GTTTTACACCCCTGCCCCAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997685688_997685696 10 Left 997685688 5:135786186-135786208 CCCATGGGGCAGGGGTGTAAAAC No data
Right 997685696 5:135786219-135786241 CCATGGATCGTATATTCAGAGGG No data
997685688_997685698 16 Left 997685688 5:135786186-135786208 CCCATGGGGCAGGGGTGTAAAAC No data
Right 997685698 5:135786225-135786247 ATCGTATATTCAGAGGGGAGAGG No data
997685688_997685690 -7 Left 997685688 5:135786186-135786208 CCCATGGGGCAGGGGTGTAAAAC No data
Right 997685690 5:135786202-135786224 GTAAAACCCTCCTTGCACCATGG No data
997685688_997685699 17 Left 997685688 5:135786186-135786208 CCCATGGGGCAGGGGTGTAAAAC No data
Right 997685699 5:135786226-135786248 TCGTATATTCAGAGGGGAGAGGG No data
997685688_997685694 9 Left 997685688 5:135786186-135786208 CCCATGGGGCAGGGGTGTAAAAC No data
Right 997685694 5:135786218-135786240 ACCATGGATCGTATATTCAGAGG No data
997685688_997685697 11 Left 997685688 5:135786186-135786208 CCCATGGGGCAGGGGTGTAAAAC No data
Right 997685697 5:135786220-135786242 CATGGATCGTATATTCAGAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997685688 Original CRISPR GTTTTACACCCCTGCCCCAT GGG (reversed) Intergenic
No off target data available for this crispr