ID: 997685689

View in Genome Browser
Species Human (GRCh38)
Location 5:135786187-135786209
Sequence GGTTTTACACCCCTGCCCCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997685689_997685699 16 Left 997685689 5:135786187-135786209 CCATGGGGCAGGGGTGTAAAACC No data
Right 997685699 5:135786226-135786248 TCGTATATTCAGAGGGGAGAGGG No data
997685689_997685694 8 Left 997685689 5:135786187-135786209 CCATGGGGCAGGGGTGTAAAACC No data
Right 997685694 5:135786218-135786240 ACCATGGATCGTATATTCAGAGG No data
997685689_997685696 9 Left 997685689 5:135786187-135786209 CCATGGGGCAGGGGTGTAAAACC No data
Right 997685696 5:135786219-135786241 CCATGGATCGTATATTCAGAGGG No data
997685689_997685698 15 Left 997685689 5:135786187-135786209 CCATGGGGCAGGGGTGTAAAACC No data
Right 997685698 5:135786225-135786247 ATCGTATATTCAGAGGGGAGAGG No data
997685689_997685690 -8 Left 997685689 5:135786187-135786209 CCATGGGGCAGGGGTGTAAAACC No data
Right 997685690 5:135786202-135786224 GTAAAACCCTCCTTGCACCATGG No data
997685689_997685697 10 Left 997685689 5:135786187-135786209 CCATGGGGCAGGGGTGTAAAACC No data
Right 997685697 5:135786220-135786242 CATGGATCGTATATTCAGAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997685689 Original CRISPR GGTTTTACACCCCTGCCCCA TGG (reversed) Intergenic
No off target data available for this crispr