ID: 997685692

View in Genome Browser
Species Human (GRCh38)
Location 5:135786209-135786231
Sequence ATACGATCCATGGTGCAAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997685692_997685699 -6 Left 997685692 5:135786209-135786231 CCTCCTTGCACCATGGATCGTAT No data
Right 997685699 5:135786226-135786248 TCGTATATTCAGAGGGGAGAGGG No data
997685692_997685698 -7 Left 997685692 5:135786209-135786231 CCTCCTTGCACCATGGATCGTAT No data
Right 997685698 5:135786225-135786247 ATCGTATATTCAGAGGGGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997685692 Original CRISPR ATACGATCCATGGTGCAAGG AGG (reversed) Intergenic
No off target data available for this crispr