ID: 997685699

View in Genome Browser
Species Human (GRCh38)
Location 5:135786226-135786248
Sequence TCGTATATTCAGAGGGGAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997685693_997685699 -9 Left 997685693 5:135786212-135786234 CCTTGCACCATGGATCGTATATT No data
Right 997685699 5:135786226-135786248 TCGTATATTCAGAGGGGAGAGGG No data
997685687_997685699 18 Left 997685687 5:135786185-135786207 CCCCATGGGGCAGGGGTGTAAAA No data
Right 997685699 5:135786226-135786248 TCGTATATTCAGAGGGGAGAGGG No data
997685692_997685699 -6 Left 997685692 5:135786209-135786231 CCTCCTTGCACCATGGATCGTAT No data
Right 997685699 5:135786226-135786248 TCGTATATTCAGAGGGGAGAGGG No data
997685688_997685699 17 Left 997685688 5:135786186-135786208 CCCATGGGGCAGGGGTGTAAAAC No data
Right 997685699 5:135786226-135786248 TCGTATATTCAGAGGGGAGAGGG No data
997685691_997685699 -5 Left 997685691 5:135786208-135786230 CCCTCCTTGCACCATGGATCGTA No data
Right 997685699 5:135786226-135786248 TCGTATATTCAGAGGGGAGAGGG No data
997685689_997685699 16 Left 997685689 5:135786187-135786209 CCATGGGGCAGGGGTGTAAAACC No data
Right 997685699 5:135786226-135786248 TCGTATATTCAGAGGGGAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997685699 Original CRISPR TCGTATATTCAGAGGGGAGA GGG Intergenic
No off target data available for this crispr