ID: 997687266

View in Genome Browser
Species Human (GRCh38)
Location 5:135797184-135797206
Sequence GTGTACACCCACTGCGATAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997687266_997687271 12 Left 997687266 5:135797184-135797206 CCAATATCGCAGTGGGTGTACAC No data
Right 997687271 5:135797219-135797241 TTGTTTCTAATATCCAGAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997687266 Original CRISPR GTGTACACCCACTGCGATAT TGG (reversed) Intergenic
No off target data available for this crispr