ID: 997691228

View in Genome Browser
Species Human (GRCh38)
Location 5:135828815-135828837
Sequence CTGTAGGAGGGGCAGCTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997691228_997691239 -7 Left 997691228 5:135828815-135828837 CCTTCCAGCTGCCCCTCCTACAG No data
Right 997691239 5:135828831-135828853 CCTACAGCCATGGGGGCTTTGGG No data
997691228_997691237 -8 Left 997691228 5:135828815-135828837 CCTTCCAGCTGCCCCTCCTACAG No data
Right 997691237 5:135828830-135828852 TCCTACAGCCATGGGGGCTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997691228 Original CRISPR CTGTAGGAGGGGCAGCTGGA AGG (reversed) Intergenic
No off target data available for this crispr