ID: 997694326

View in Genome Browser
Species Human (GRCh38)
Location 5:135849623-135849645
Sequence TATGTAGGACCACCCAACTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 91
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 81}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997694326_997694330 3 Left 997694326 5:135849623-135849645 CCCTAGTTGGGTGGTCCTACATA 0: 1
1: 0
2: 0
3: 9
4: 81
Right 997694330 5:135849649-135849671 TCTATATAATCAAATACATAGGG 0: 1
1: 0
2: 4
3: 50
4: 451
997694326_997694329 2 Left 997694326 5:135849623-135849645 CCCTAGTTGGGTGGTCCTACATA 0: 1
1: 0
2: 0
3: 9
4: 81
Right 997694329 5:135849648-135849670 CTCTATATAATCAAATACATAGG 0: 1
1: 0
2: 0
3: 27
4: 293

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997694326 Original CRISPR TATGTAGGACCACCCAACTA GGG (reversed) Intronic
901721300 1:11200285-11200307 TTTTTATGACCATCCAACTAAGG - Intronic
909506064 1:76391376-76391398 CATGTACAACCACCCAACTGGGG - Intronic
909979402 1:82080813-82080835 GTTGTAGGACCACAAAACTAAGG - Intergenic
912988391 1:114458065-114458087 TATGTGGGCCAACCTAACTATGG + Intronic
916569022 1:166008841-166008863 CAGGTGGGACCTCCCAACTAGGG - Intergenic
916803350 1:168234858-168234880 TATCCAAGGCCACCCAACTAGGG - Intronic
917259141 1:173148378-173148400 TAGGTTGGACCTCCCAACCAGGG - Intergenic
918379121 1:183937128-183937150 TATGTAGCACCACCCGCCTGTGG + Exonic
922321303 1:224490014-224490036 TATGTAGGACCAAAAAAATAGGG + Intronic
922615609 1:226959670-226959692 TATGCAGGACCACATATCTATGG + Intronic
923916784 1:238516027-238516049 TATGTAGGCCAAGCTAACTATGG + Intergenic
1064366851 10:14716233-14716255 AAGCTAGAACCACCCAACTAAGG - Intronic
1078033723 11:7780814-7780836 TGGGTAGGACTTCCCAACTAGGG + Intergenic
1078816077 11:14823569-14823591 TGGGTGGGACCTCCCAACTAGGG + Intronic
1085880562 11:80462868-80462890 TACGTGGGACCTCCCAACTGTGG + Intergenic
1088981845 11:114871317-114871339 GATTTATGACCACCCAACCAAGG + Intergenic
1092586282 12:9904512-9904534 TCTCTAGAACCACCCAACTAAGG - Intronic
1106474992 13:30090693-30090715 TGTCTAGGACCACCCAAGTGAGG - Intergenic
1108734690 13:53270382-53270404 TATTTTGGACCACACAACTATGG + Intergenic
1113546549 13:111155235-111155257 TATGTAGGATAACCCAACAGAGG + Intronic
1116252065 14:42499058-42499080 TATGAAGGAACACCCAACACTGG - Intergenic
1118049388 14:62010339-62010361 AATATAGGACCACCCTATTAAGG - Intronic
1119189817 14:72673454-72673476 TAGGTAGTACCAACCAACCATGG + Intronic
1119870269 14:78011168-78011190 TCTGTAGGAACCCCCAGCTAAGG - Intergenic
1137541561 16:49365762-49365784 TATGTAGGCCAAGCCAAGTAAGG - Intergenic
1143073662 17:4320426-4320448 TATGAATGACAACCCAGCTAAGG - Intronic
1203170504 17_GL000205v2_random:144452-144474 TATTTAGTACAACACAACTATGG + Intergenic
1154181971 18:12145922-12145944 TTTGTAGGACCTCCCAAATGGGG + Intergenic
1155785227 18:29888876-29888898 TATGTAGGACCATCCACAAAAGG - Intergenic
1156700028 18:39814915-39814937 TGGGCAGGACCTCCCAACTAGGG - Intergenic
1157349995 18:46875632-46875654 TCTCCAGAACCACCCAACTAAGG + Intronic
1166264182 19:41667174-41667196 TATGTAGGACAGCCTAACTGTGG - Intronic
930305163 2:49667223-49667245 TGGGTAGGACCTCCCAACTCAGG - Intergenic
931543319 2:63353661-63353683 TTGGCAGGACCTCCCAACTAGGG + Intronic
931562735 2:63580148-63580170 TATGTAGGAGCAGCAAACAAAGG + Intronic
934623990 2:95833273-95833295 AGTGAAGGACCTCCCAACTAGGG - Intergenic
937520370 2:122706566-122706588 CATGTAGGACAAGCTAACTATGG + Intergenic
939858523 2:147390104-147390126 TATGTAGTACCACAGAAATAGGG - Intergenic
941253801 2:163201655-163201677 TATGAAGAACTACACAACTAAGG + Intergenic
1170472433 20:16681664-16681686 TATTTAGAATGACCCAACTATGG + Intergenic
1170508570 20:17054278-17054300 TGGGTGGGACCTCCCAACTAGGG - Intergenic
1170743055 20:19074630-19074652 TATGTGAGACCTCACAACTAAGG + Intergenic
1171282130 20:23909962-23909984 TGGGTAGGACCTCCCAACTGGGG - Intergenic
1176326494 21:5506283-5506305 TATGTAGTACAACACAACTATGG + Intergenic
1176331218 21:5549922-5549944 TATTTAGTACAACACAACTATGG - Intergenic
1176396539 21:6271029-6271051 TATTTAGTACAACACAACTATGG + Intergenic
1176401263 21:6314668-6314690 TATGTAGTACAACACAACTATGG - Intergenic
1176435894 21:6674436-6674458 TATGTAGTACAACACAACTATGG + Intergenic
1176440618 21:6718075-6718097 TATTTAGTACAACACAACTATGG - Intergenic
1176460156 21:7001506-7001528 TATGTAGTACAACACAACTATGG + Intergenic
1176464880 21:7045144-7045166 TATTTAGTACAACACAACTATGG - Intergenic
1176483717 21:7383284-7383306 TATGTAGTACAACACAACTATGG + Intergenic
1176488441 21:7426923-7426945 TATTTAGTACAACACAACTATGG - Intergenic
952557251 3:34546752-34546774 TATGTAGATTCAACCAACTATGG + Intergenic
960685197 3:120287990-120288012 TAGGTGGGACCTCCCAACCAGGG + Intergenic
960841444 3:121963255-121963277 TAAGTGGGACCTCCCAACCAGGG + Intergenic
977006366 4:91572615-91572637 TGTGTGGGACCTCCCAACTGGGG - Intronic
978305420 4:107323131-107323153 TGGGTGGGACCTCCCAACTAGGG - Intergenic
982093487 4:151899648-151899670 CATGTGGGACCACACAACTGTGG - Intergenic
993287651 5:86020724-86020746 TATGGAGGACCAACTCACTATGG - Intergenic
995789903 5:115875389-115875411 GATGAAGGCCCACCCAATTATGG + Intronic
997205351 5:132045169-132045191 TATGTGGGACCTCCCAACTGGGG - Intergenic
997694326 5:135849623-135849645 TATGTAGGACCACCCAACTAGGG - Intronic
1000443686 5:161294141-161294163 TATGCGGGACCACCGATCTATGG + Exonic
1012616309 6:101283490-101283512 TAGGTGGGACCTCCCAACTGGGG + Intergenic
1016666040 6:146641589-146641611 TAAGTAAGACCACACATCTACGG + Intronic
1016680635 6:146825095-146825117 TATGTAGGCCAAGCCAACTATGG - Intergenic
1017218799 6:151941879-151941901 TATGCAGAACAACCCATCTACGG + Intronic
1021119755 7:16785781-16785803 TATTTAGGACTACTAAACTATGG + Intergenic
1024491789 7:49994252-49994274 TATGCAGGACCACCCAAAAGTGG - Intronic
1024795261 7:53012459-53012481 TATGTAAGACCTCCCAACAGGGG - Intergenic
1027627788 7:80565545-80565567 TAGGTGGGACCTCCCAACCAGGG - Intronic
1032669674 7:134071713-134071735 CATGTAGGCCCAGCTAACTATGG - Intergenic
1042240107 8:66655084-66655106 TATGTAGGAGCATCAAACAAGGG - Intronic
1048743215 8:137585377-137585399 TATGTAGAACCACCTAAGAAGGG + Intergenic
1051913979 9:22185697-22185719 TGGGTAAGACCACCCAACTGGGG + Intergenic
1054788534 9:69233266-69233288 AATTAAGGCCCACCCAACTAAGG + Intronic
1055334272 9:75217271-75217293 TATGGAGGACCACCATGCTAAGG + Intergenic
1056127995 9:83555332-83555354 TGGGTAGGACCTCCCAACTGGGG - Intergenic
1203430884 Un_GL000195v1:90405-90427 TATTTAGTACAACACAACTATGG + Intergenic
1203435626 Un_GL000195v1:134224-134246 TATTTAGTACAACACAACTATGG - Intergenic
1188793808 X:34437882-34437904 TGTGCAGGACCTCCCAACCAGGG + Intergenic
1191743875 X:64464877-64464899 TGGGTGGGACCTCCCAACTAGGG - Intergenic
1191988758 X:67009884-67009906 TGGGCAGGACCTCCCAACTAGGG + Intergenic
1192926270 X:75758405-75758427 TGGGTGGGACCTCCCAACTAGGG + Intergenic
1193075933 X:77355636-77355658 TATGTAGTCTCACCCAACTCTGG - Intergenic
1193858876 X:86639891-86639913 TGAGAAGGACCTCCCAACTACGG + Intronic
1194188758 X:90808352-90808374 TATGTAGAACCTCCCAAATGGGG - Intergenic
1194948001 X:100091578-100091600 TGGGTGGGACCTCCCAACTAGGG + Intergenic
1196528758 X:116759035-116759057 TTTGCAGGACCTCCCAACTGGGG + Intergenic
1200535340 Y:4390249-4390271 TATGTAGAACCTCCCAAATGGGG - Intergenic