ID: 997696193

View in Genome Browser
Species Human (GRCh38)
Location 5:135862940-135862962
Sequence TGATGCAATCAGAGTGGTGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 186
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 172}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997696193 Original CRISPR TGATGCAATCAGAGTGGTGT TGG Intronic
900662765 1:3793780-3793802 AGGTGCAATCATAGGGGTGTGGG - Intronic
900790700 1:4678209-4678231 TGAAGCAGTTAGAGTGGTGTTGG + Intronic
903925844 1:26829926-26829948 ATATGCAATCAGACTTGTGTGGG - Intronic
905160114 1:36025612-36025634 TGAAGGAATCAGAGTGTTTTGGG + Intronic
905321872 1:37123382-37123404 AGATGCATTCAGGGTGGTGAAGG - Intergenic
906509289 1:46401684-46401706 GGATGACATCAGCGTGGTGTTGG + Intronic
906853556 1:49280167-49280189 GGGTGCAATCATAGGGGTGTGGG - Intronic
909128687 1:71707727-71707749 TTATGCAATCATAGTGGTGGTGG + Intronic
910739433 1:90498862-90498884 TGATGCATTCAGGGTGTTATTGG + Intergenic
910747747 1:90591628-90591650 TGCTGCATTCACAGTAGTGTAGG - Intergenic
912461440 1:109834829-109834851 TGATGAAAACAGAGTGTTTTGGG - Intergenic
916231242 1:162543583-162543605 GGATGCAATCATAGGAGTGTAGG + Intergenic
917148282 1:171916336-171916358 TAAAGCAATCAGATTGGTGCTGG + Intronic
917510100 1:175662641-175662663 TGATGCAAACAGAATGGAGCTGG + Intronic
920100789 1:203515795-203515817 GAATGCAAGCAGAGTGGGGTGGG + Intergenic
921153312 1:212418658-212418680 GGTTGCAATCACAGGGGTGTGGG + Intergenic
921994109 1:221397868-221397890 TGGTGCAGTCATAGTGGTGGGGG + Intergenic
922056316 1:222045587-222045609 TGATGCACTCAGAGTGTTCAAGG + Intergenic
922329915 1:224565479-224565501 GAATGCAAGCAGGGTGGTGTCGG - Intronic
924269762 1:242320377-242320399 TGATGCCATGAAAGTGGTGGAGG + Intronic
924374592 1:243391855-243391877 TGAAGCATTCAGAGTGGGTTTGG + Intronic
924465800 1:244298304-244298326 GGGTGCAATCATAGGGGTGTGGG + Intergenic
1063451741 10:6154669-6154691 GGCTGCGATCAGGGTGGTGTTGG + Intronic
1064422559 10:15203285-15203307 GGGTGCAATCATAGGGGTGTGGG - Intergenic
1066330553 10:34417057-34417079 GGATGAAATCATAGGGGTGTGGG - Intronic
1066715149 10:38278400-38278422 TGATGCCATGAAAGTGGTGGAGG - Intergenic
1069746061 10:70715778-70715800 TGATGCATTCAGAAGGGGGTAGG + Intronic
1070534640 10:77366566-77366588 TGATGGTATGAGGGTGGTGTTGG + Intronic
1071073874 10:81728606-81728628 GGTTGCAATCATAGGGGTGTTGG + Intergenic
1074222596 10:111452921-111452943 TGATGAAATGGGAGGGGTGTGGG + Intergenic
1074493921 10:113962192-113962214 TGAGGCAAACAGAATGGTTTAGG + Intergenic
1074555584 10:114486178-114486200 AGATGTTATCAGAGTGTTGTTGG + Intronic
1075420093 10:122294261-122294283 TGATGCTATCAGAGTGACCTGGG - Intronic
1075817946 10:125280175-125280197 TGATGCAATCTCAGTTGTTTGGG - Intergenic
1076324060 10:129607282-129607304 GGAAGAAATCAGAGTGGTTTTGG + Intronic
1078720081 11:13876118-13876140 TGATGCAAATAGAGGGGTGAGGG + Intergenic
1082109096 11:48253558-48253580 TTTTGCATTCAGAGTGATGTGGG + Intergenic
1082792564 11:57356845-57356867 TGATGCAATTAGAGTGATCTTGG + Intronic
1084864243 11:72042532-72042554 AGATGGAAACAGAGAGGTGTGGG + Intronic
1084930828 11:72554221-72554243 GGCTGAAATCACAGTGGTGTCGG + Intergenic
1090374987 11:126282420-126282442 CGCTGCAAACAGCGTGGTGTAGG - Intergenic
1093996827 12:25652076-25652098 TGATGCAATCAGCATGGAGAGGG - Intergenic
1093999439 12:25679194-25679216 TGAGGCATTCAGAGTGCAGTTGG + Intergenic
1095285278 12:40403331-40403353 TCTTGCAATCAGTGTGGTCTTGG - Intronic
1096358248 12:50961199-50961221 TGATGTAATGAGAGAGGGGTAGG + Intronic
1102037194 12:109777944-109777966 GTATGCAAACAGAGAGGTGTAGG + Intergenic
1102652891 12:114455375-114455397 TGATTCAATGAGGGTGGAGTGGG - Intergenic
1103134035 12:118492204-118492226 TGATGAACTCAAAGTGGTGTTGG - Intergenic
1104320136 12:127743004-127743026 GGGTGCAATCACAGGGGTGTGGG + Intergenic
1106444078 13:29808623-29808645 TGAGACAATGAGGGTGGTGTGGG - Intronic
1107191746 13:37596320-37596342 TAATGCAATCAGAAAGGTTTAGG - Intronic
1108495573 13:51021192-51021214 AGATGCAGTCAGCGTGGTGTAGG - Intergenic
1109469843 13:62790665-62790687 TGATCCACTCAGAGTGGGGAGGG + Intergenic
1112022792 13:95386091-95386113 GGATGAAATCATAGGGGTGTAGG - Intergenic
1113190969 13:107745472-107745494 TGATGGAATCAAATTTGTGTTGG - Intronic
1114779138 14:25518802-25518824 TAAAGCAACCAAAGTGGTGTTGG - Intergenic
1115837490 14:37424891-37424913 TGATGTAATCAGCATGGGGTGGG - Intronic
1120768271 14:88351733-88351755 ATATGCATTCATAGTGGTGTAGG + Intergenic
1122698540 14:103570897-103570919 GGGTGCAATCACAGGGGTGTGGG + Intronic
1126739263 15:51761180-51761202 AGATGCAATCAGAGTAGTGCAGG + Intronic
1128427930 15:67561715-67561737 TCATGCTATCAGATTGCTGTTGG + Intronic
1133564414 16:6979821-6979843 AGATGCACTCAGGCTGGTGTTGG + Intronic
1135079128 16:19419067-19419089 GTATGCAATCAGAGAGGTATGGG + Intronic
1137394146 16:48105169-48105191 GGATGCCATCAGTGTGGTCTTGG + Exonic
1138705248 16:58908932-58908954 GGGTGCAATCATAGGGGTGTGGG - Intergenic
1138734847 16:59238580-59238602 AGATGAAATCACAGGGGTGTGGG - Intergenic
1139342420 16:66276975-66276997 TGATGTACTCAGAGTGCTGAAGG + Intergenic
1141911364 16:87060590-87060612 GAATGCAATCAGAGTGCTTTTGG - Intergenic
1141930562 16:87199699-87199721 CGATGCAACCAAAATGGTGTGGG - Intronic
1146179683 17:30689602-30689624 GGTTGCAATCAGGGTGGTGCAGG + Intergenic
1146823589 17:36004075-36004097 GGGTGCAATCATAGAGGTGTGGG + Intergenic
1148945255 17:51256915-51256937 TGATACAATAAGAGGGGTGCTGG - Intronic
1150600930 17:66650333-66650355 TGATATTATCAGAATGGTGTCGG + Intronic
1151567058 17:74904545-74904567 TGCTCCAGCCAGAGTGGTGTTGG + Intergenic
1153075211 18:1155406-1155428 TAGTGCAATCACAGTGGTGGTGG - Intergenic
1153106425 18:1533419-1533441 TGATGCCATCAGATTTGTTTTGG - Intergenic
1156518842 18:37704440-37704462 TGATGAATTCAGAGGGGTGATGG + Intergenic
1157929842 18:51809565-51809587 TGATTCCATCAGAATGGTGGTGG + Intergenic
1160307102 18:77750123-77750145 TGATGCAGACAGGCTGGTGTTGG + Intergenic
1161914466 19:7218204-7218226 TGTTGCAACCAGTGTGGGGTGGG + Intronic
1162978927 19:14225960-14225982 GGTTGCAATCAGGGTGGTGCAGG - Intergenic
1163533186 19:17862574-17862596 AGGTGCAATCAGGGAGGTGTGGG - Intronic
1164838212 19:31372441-31372463 TGATGCAACCACAGTGCTGCAGG + Intergenic
1165275680 19:34749160-34749182 TGCAGCCATCAGAGTGGTATTGG + Intergenic
1166137314 19:40785642-40785664 TTTTGCCATCAGAGAGGTGTGGG + Intronic
1168370866 19:55832859-55832881 TGTTGAAATAAGAGTGGTGACGG - Intronic
927877395 2:26667682-26667704 TGATGAATGCAGAGTGATGTTGG - Intergenic
928323147 2:30299863-30299885 TCATGCAAACAGTGTGGTATTGG - Intronic
928671441 2:33607315-33607337 GGATGCAATCATAGGGTTGTTGG + Intergenic
929000373 2:37342552-37342574 TGATACATACATAGTGGTGTTGG + Intergenic
931110621 2:59106867-59106889 AGAAGCCATGAGAGTGGTGTGGG + Intergenic
931501574 2:62874882-62874904 GCATGCCATCAAAGTGGTGTGGG - Intronic
931865030 2:66400156-66400178 TGATGAAATCATACTGGAGTAGG + Intergenic
933607381 2:84397539-84397561 TACTGCAATCATTGTGGTGTAGG + Intergenic
933690900 2:85178867-85178889 AGATCCAATCACAGTGGGGTTGG - Intronic
934794195 2:97086419-97086441 TTCTGCAGTCACAGTGGTGTGGG - Intronic
936923398 2:117712242-117712264 TGAGGCAATTAGAGAGTTGTGGG + Intergenic
942591827 2:177554457-177554479 TGATGCAATATGGTTGGTGTTGG - Intergenic
943142992 2:184006101-184006123 TGATCCAATCAGAGTTCTGAGGG + Intergenic
943731891 2:191310660-191310682 TGATTCAAGCAGATTGGTATTGG - Intronic
944181008 2:196894266-196894288 GGAGGCAATCAGAATGGTGAAGG - Intronic
944562294 2:200952702-200952724 TGATGCTATCTGAGTGTAGTAGG - Intronic
945194124 2:207222366-207222388 TGAAGCAAACAGAGCTGTGTTGG - Intergenic
947145620 2:227061379-227061401 TGATCCAATCAGAGGTGTGGAGG + Intronic
948305930 2:236946783-236946805 GGATGCATTCAGAGTGGTGGTGG + Intergenic
1172606405 20:36217093-36217115 TGATGTAAACAGAGTGATGGGGG + Intronic
1174103028 20:48141677-48141699 GGATGCAATCATAGGGGTGTGGG - Intergenic
1183176148 22:36226087-36226109 TGATGGCAGCAGAGTGGTGGGGG - Intergenic
1183182178 22:36267625-36267647 TGATGGCAGCAGAGTGGTGGGGG + Intergenic
1183955834 22:41380455-41380477 TGATGCAATCAGAATTTTGCTGG - Intronic
951673959 3:25216051-25216073 TGAAGCAGTCAGAGAGGTGCAGG + Intronic
952538127 3:34335614-34335636 TCATACAATCAGAGTGCTCTGGG + Intergenic
954861555 3:53694870-53694892 CGATGCAGTCACAGTGGGGTGGG + Intronic
959454443 3:106541422-106541444 TGATCCACTCAGAGTGGGGTGGG - Intergenic
964453739 3:156838128-156838150 TGATCCACTCAAAGTGGGGTGGG + Intronic
967478403 3:189946780-189946802 TGGTGAAACCAGAGTGGTGGTGG + Intergenic
969967190 4:11009257-11009279 TAAAGCACTGAGAGTGGTGTGGG + Intergenic
970471661 4:16385430-16385452 TAATTCAATCAGAGTGCAGTGGG + Intergenic
981507925 4:145523360-145523382 TGTTGCAATCTGTGTGGTGATGG + Intronic
982400936 4:154967054-154967076 TGATGCAATCTGTGGGGTGAAGG - Intergenic
984423496 4:179554438-179554460 TAATGCAATCTGAGTGGAGAAGG + Intergenic
986668844 5:10126115-10126137 AGATGCAATCAGAGATGGGTAGG + Intergenic
988071916 5:26301856-26301878 TGAAGAAATAATAGTGGTGTGGG + Intergenic
992450422 5:76871123-76871145 TGATGCTACCAGAGTGAGGTTGG - Intronic
996689928 5:126329475-126329497 TGAGGCAATCAGAATGCTTTTGG + Intergenic
997696193 5:135862940-135862962 TGATGCAATCAGAGTGGTGTTGG + Intronic
998820603 5:146054314-146054336 TGATGGAATAAGGCTGGTGTGGG + Intronic
999645778 5:153715679-153715701 AGATGCCCTCAGAGAGGTGTAGG - Intronic
1000265033 5:159627935-159627957 TGCAGCAACCTGAGTGGTGTTGG + Intergenic
1002939587 6:1704357-1704379 TGAGGCTGGCAGAGTGGTGTGGG + Intronic
1002993380 6:2258600-2258622 AGATGAAGTCAGAGTGGCGTAGG - Intergenic
1004474513 6:15958961-15958983 GGGTGCAATCACAGGGGTGTGGG + Intergenic
1004566780 6:16805363-16805385 TGATGCAGTCGGTGTGGGGTGGG + Intergenic
1005449567 6:25959690-25959712 TGATGCACGTAGTGTGGTGTGGG - Intergenic
1005985676 6:30873086-30873108 GGTTGCAATCATAGGGGTGTGGG - Intergenic
1008634707 6:53398502-53398524 TGATGAAATCAGAATAGTGGTGG - Intergenic
1009985165 6:70773055-70773077 TGATGCATTGATAGTGGTGGTGG + Intronic
1009998588 6:70925076-70925098 CGGTGCAATCACAGAGGTGTGGG - Intronic
1013706088 6:112835878-112835900 TGATGGAATCTGAATGGGGTTGG - Intergenic
1014949128 6:127534807-127534829 TGATTGAATAAGAGTGTTGTGGG + Intronic
1017589018 6:155958788-155958810 TGAGGCAATCAGAGAGCTTTAGG - Intergenic
1017779988 6:157708262-157708284 GGGTGCAATCAGAGGGGTGTGGG + Intronic
1020450922 7:8319683-8319705 GGATGCAATCATAGGTGTGTGGG + Intergenic
1021528790 7:21619473-21619495 TAAAGCACTCAGAGTGGTGTTGG - Intronic
1021738366 7:23660978-23661000 GGGTGCAATCATAGTGGTGTGGG - Intergenic
1022380834 7:29858429-29858451 ATATGTAATGAGAGTGGTGTGGG - Intronic
1022754979 7:33277690-33277712 AGGTGCAATCATAGGGGTGTGGG + Intronic
1024241760 7:47440995-47441017 TAAAGCAATCAAAGTGGTGGAGG - Intronic
1028999664 7:97139674-97139696 TGCTGCTATCAGTGTGGGGTAGG + Intronic
1031998026 7:128245703-128245725 TGATGTCATCAGAGGGCTGTGGG + Intronic
1033816771 7:145083084-145083106 TGATGCAAGCAGACAGGTGGGGG - Intergenic
1037796269 8:21997827-21997849 TGATGGATTCAGTGTGGTGGGGG + Intronic
1039322263 8:36445371-36445393 AGATGAAATCATAGGGGTGTGGG + Intergenic
1039454371 8:37697576-37697598 TCTTGCAGTCAGAGTGGTGCGGG - Exonic
1039961335 8:42250207-42250229 TAATGCAATCACAGGGGTGTGGG + Intergenic
1040415253 8:47189312-47189334 GGATGCCATCACAGTGGTGATGG - Intergenic
1041055332 8:53979877-53979899 GGATGCAATCATAGGGATGTGGG - Intronic
1042858641 8:73293202-73293224 TGATTGAACCAGAGTGGTGGTGG - Intronic
1043161624 8:76854081-76854103 TGATGGAATCAGGGGGGTGCTGG - Exonic
1045647951 8:104317605-104317627 GGATGAAATCACAGGGGTGTGGG + Intergenic
1047471330 8:125176040-125176062 TGTTGCAGTCACAGGGGTGTTGG + Intronic
1048224633 8:132573183-132573205 TGATTCAATAAGTCTGGTGTTGG + Intronic
1048376306 8:133825561-133825583 TGTTGCAATCAGAGAGATGAAGG - Intergenic
1048579496 8:135719408-135719430 GGAGGCAGTCAGAGTGGTCTAGG + Intergenic
1048849876 8:138634783-138634805 CCATGCAATTAGAGTGATGTTGG - Intronic
1051890106 9:21932604-21932626 GGGTGCAATCATAGGGGTGTGGG - Intronic
1052251435 9:26402341-26402363 CGATGCCATCAGAATGGTGGGGG - Intergenic
1052492132 9:29183324-29183346 TCATGTGATCAGAGTGATGTTGG - Intergenic
1053456150 9:38234420-38234442 TGTTGAAATGAGGGTGGTGTGGG + Intergenic
1055484650 9:76745547-76745569 GGGTGCAATCATAGAGGTGTGGG - Intronic
1055805114 9:80084093-80084115 TACTGAAATCAGAGTGGTTTGGG - Intergenic
1056827485 9:89886675-89886697 TAATGCAGTCACAGTGGTCTTGG + Intergenic
1057720751 9:97529995-97530017 GGATGCAATCTGAGCGGTGCTGG + Intronic
1059916893 9:119113883-119113905 TGATCCAATGAGAGTGGGGAAGG + Intergenic
1060988211 9:127832650-127832672 TGAAGCAATGAGAGTGGAGAAGG + Intronic
1185781397 X:2850488-2850510 TCATGCAATCAGAGGTGGGTGGG + Intronic
1185803845 X:3038932-3038954 TCATGCAATCAGAGGTGGGTGGG + Intergenic
1186404312 X:9288387-9288409 TTATGTAATCAGTGTGATGTGGG - Intergenic
1188750913 X:33904931-33904953 AGATGGAATCATAGGGGTGTGGG + Intergenic
1190424391 X:50318817-50318839 TTATGCAAACAGTGTGGTTTAGG + Intronic
1193524409 X:82572162-82572184 TAGTGCAGTCAGAGTGGTGGTGG - Intergenic
1195220750 X:102743752-102743774 GGGTGCAATCATAGGGGTGTGGG + Intronic
1195966056 X:110431394-110431416 TGAAGCAATGAGAGTGGGATTGG + Intronic
1196098541 X:111825032-111825054 TGATTCAATCAGATACGTGTTGG + Intronic
1197758139 X:130010439-130010461 AGATGCAGTCAGGGTGGTCTCGG - Intronic
1201734102 Y:17238652-17238674 GGATGAAATCACAGGGGTGTGGG - Intergenic