ID: 997698345

View in Genome Browser
Species Human (GRCh38)
Location 5:135878993-135879015
Sequence GTGTCGGCTCATAAATGTGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 54
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 52}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997698345_997698351 11 Left 997698345 5:135878993-135879015 CCATCACATTTATGAGCCGACAC 0: 1
1: 0
2: 0
3: 1
4: 52
Right 997698351 5:135879027-135879049 CAAGAAGATTGAGGGAGGAAAGG 0: 1
1: 1
2: 8
3: 64
4: 657
997698345_997698352 22 Left 997698345 5:135878993-135879015 CCATCACATTTATGAGCCGACAC 0: 1
1: 0
2: 0
3: 1
4: 52
Right 997698352 5:135879038-135879060 AGGGAGGAAAGGAAGATCATAGG No data
997698345_997698347 2 Left 997698345 5:135878993-135879015 CCATCACATTTATGAGCCGACAC 0: 1
1: 0
2: 0
3: 1
4: 52
Right 997698347 5:135879018-135879040 AACACCAAGCAAGAAGATTGAGG 0: 1
1: 0
2: 1
3: 10
4: 222
997698345_997698350 6 Left 997698345 5:135878993-135879015 CCATCACATTTATGAGCCGACAC 0: 1
1: 0
2: 0
3: 1
4: 52
Right 997698350 5:135879022-135879044 CCAAGCAAGAAGATTGAGGGAGG 0: 1
1: 1
2: 0
3: 19
4: 198
997698345_997698348 3 Left 997698345 5:135878993-135879015 CCATCACATTTATGAGCCGACAC 0: 1
1: 0
2: 0
3: 1
4: 52
Right 997698348 5:135879019-135879041 ACACCAAGCAAGAAGATTGAGGG 0: 1
1: 0
2: 0
3: 16
4: 199

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997698345 Original CRISPR GTGTCGGCTCATAAATGTGA TGG (reversed) Intronic
924002621 1:239570725-239570747 TAGTCTGCTCAAAAATGTGAGGG + Intronic
1063100573 10:2946222-2946244 GTGTCTGCTCAGAGATGTGTGGG - Intergenic
1063195098 10:3734563-3734585 GTGTCTGGCCATCAATGTGAGGG - Intergenic
1068234681 10:54218469-54218491 GGGTGGGCTCTTAAATCTGATGG + Intronic
1073491946 10:103858413-103858435 GTATAGGCACATAAATGTGGAGG - Intergenic
1073935609 10:108627708-108627730 GTGTGGGATCATAAATTTTAAGG - Intergenic
1086032792 11:82380390-82380412 GTGATCGCTTATAAATGTGAGGG + Intergenic
1106547989 13:30746862-30746884 GTGTGGGATCATAAATGTTTAGG + Intronic
1107055450 13:36098818-36098840 GTGCAGGCTCATAAAACTGAGGG + Intronic
1107201486 13:37724254-37724276 GTGTAGGCCCATAAGTGTGTAGG + Intronic
1108863819 13:54897256-54897278 GGGTCAGCTCATAAAAGGGAAGG - Intergenic
1109769068 13:66946330-66946352 ATATGTGCTCATAAATGTGAAGG - Intronic
1112006037 13:95254545-95254567 GTGACGGCTGATAACTGAGAGGG - Intronic
1112617103 13:101017023-101017045 GTGTAGTCTCATAAATGTTCAGG + Intergenic
1130139124 15:81208796-81208818 GTGTGGGCTCATTAATCTGCCGG + Intronic
1133926988 16:10201352-10201374 GTGTTGGCTCTTAAATCTGCTGG - Intergenic
1136525535 16:30827317-30827339 GTGTTGACTAATAAATGTGGAGG + Intergenic
1137912192 16:52388912-52388934 GTGGCGGGACACAAATGTGATGG - Intergenic
1137919526 16:52473407-52473429 GTGTCTGCTAATAAATCTAATGG - Intronic
1139248484 16:65471801-65471823 TTGTTGGCTCATAAAACTGAGGG + Intergenic
1139300823 16:65943799-65943821 GTGGCGGCTCCTCAATGTGTGGG - Intergenic
1159047323 18:63381764-63381786 ATGCCAGCTAATAAATGTGAAGG - Intergenic
926977546 2:18530512-18530534 GTAAGGGCTCATAAATGTTAGGG + Intergenic
929511038 2:42566418-42566440 GTGTCAGCTCAGAAATGTAGAGG + Intronic
939052583 2:137325953-137325975 GTGTCTTCTCTTAAATGTGAGGG + Intronic
946136665 2:217653330-217653352 GAGTCAGCTCATAAAAGAGAAGG - Intronic
946364180 2:219238306-219238328 GTGTTGGCTCAAAAATGGTATGG + Exonic
1180257057 21:46637054-46637076 GCGTCAGCTCACAGATGTGATGG + Intronic
1181857915 22:25795696-25795718 GTGGCGGCCCAGAAATATGATGG + Intronic
1182694540 22:32187826-32187848 GTATCGTCTCATCTATGTGAAGG + Intergenic
1183592075 22:38785183-38785205 GTCTTTGCTCATGAATGTGAAGG + Intronic
950249976 3:11456714-11456736 GTTTGGACTCAAAAATGTGACGG + Intronic
953164517 3:40453068-40453090 CAGTCGGCTCTTAAATGTGGAGG - Intergenic
959316187 3:104810136-104810158 ATGTCTGCTAATAAATGTAAAGG + Intergenic
959503215 3:107130673-107130695 GTGGCTGGTCATGAATGTGAAGG + Intergenic
962960603 3:140308006-140308028 AAGTTGGCTCATGAATGTGAAGG + Intronic
970620406 4:17811415-17811437 GTGTCGGCTCAGAAAAGCCAAGG - Intronic
993545869 5:89212340-89212362 TTTTCATCTCATAAATGTGACGG + Intergenic
997698345 5:135878993-135879015 GTGTCGGCTCATAAATGTGATGG - Intronic
1006514236 6:34537215-34537237 GAGCCGGGTGATAAATGTGAGGG + Intergenic
1007174297 6:39885630-39885652 GTGTGGGCTCAGAGAGGTGAGGG - Intronic
1010814372 6:80339694-80339716 GTGTAGGCTAAGATATGTGAAGG - Intronic
1018045564 6:159963151-159963173 CTGTCCCCTCATAACTGTGAGGG - Intergenic
1018619575 6:165716902-165716924 GTGACGGCTGATCAGTGTGAAGG - Intronic
1031058222 7:117018067-117018089 TTGTTGGCTCATACATGAGAGGG - Intronic
1039413517 8:37375134-37375156 CTGGCGGCTCTGAAATGTGAAGG - Intergenic
1040682085 8:49823249-49823271 GTGTAGACTCATAACTGTAAAGG - Intergenic
1044624060 8:94218780-94218802 GTTTGGGCTCATAAATATAATGG + Intergenic
1044845531 8:96376882-96376904 GTGTGGGCCCAGAAAAGTGAGGG + Intergenic
1045871334 8:106930506-106930528 GTCCAGACTCATAAATGTGAAGG - Intergenic
1054934838 9:70676071-70676093 GTTTCTCCTCATAAATGTCAAGG - Intronic
1189735961 X:44070126-44070148 GTGTAGGAACATAAAGGTGAGGG + Intergenic
1198607808 X:138362299-138362321 ATCTCAGCTCATTAATGTGAAGG + Intergenic
1199170032 X:144725148-144725170 GTGTCTGATCAATAATGTGATGG + Intergenic