ID: 997698405

View in Genome Browser
Species Human (GRCh38)
Location 5:135879496-135879518
Sequence TTCACAGGACATCCCAAAAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 162
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 148}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997698405_997698418 26 Left 997698405 5:135879496-135879518 CCACTTTTGGGATGTCCTGTGAA 0: 1
1: 0
2: 0
3: 13
4: 148
Right 997698418 5:135879545-135879567 CTGGGTGCTCTGTCTACTCAGGG 0: 1
1: 0
2: 2
3: 20
4: 179
997698405_997698414 3 Left 997698405 5:135879496-135879518 CCACTTTTGGGATGTCCTGTGAA 0: 1
1: 0
2: 0
3: 13
4: 148
Right 997698414 5:135879522-135879544 CCTGCTACAGGGATTGGGCATGG 0: 1
1: 0
2: 0
3: 14
4: 183
997698405_997698417 25 Left 997698405 5:135879496-135879518 CCACTTTTGGGATGTCCTGTGAA 0: 1
1: 0
2: 0
3: 13
4: 148
Right 997698417 5:135879544-135879566 GCTGGGTGCTCTGTCTACTCAGG 0: 1
1: 0
2: 0
3: 10
4: 145
997698405_997698410 -2 Left 997698405 5:135879496-135879518 CCACTTTTGGGATGTCCTGTGAA 0: 1
1: 0
2: 0
3: 13
4: 148
Right 997698410 5:135879517-135879539 AAGCCCCTGCTACAGGGATTGGG 0: 1
1: 0
2: 1
3: 12
4: 111
997698405_997698409 -3 Left 997698405 5:135879496-135879518 CCACTTTTGGGATGTCCTGTGAA 0: 1
1: 0
2: 0
3: 13
4: 148
Right 997698409 5:135879516-135879538 GAAGCCCCTGCTACAGGGATTGG 0: 1
1: 0
2: 1
3: 18
4: 150
997698405_997698406 -9 Left 997698405 5:135879496-135879518 CCACTTTTGGGATGTCCTGTGAA 0: 1
1: 0
2: 0
3: 13
4: 148
Right 997698406 5:135879510-135879532 TCCTGTGAAGCCCCTGCTACAGG 0: 1
1: 0
2: 0
3: 30
4: 188
997698405_997698415 7 Left 997698405 5:135879496-135879518 CCACTTTTGGGATGTCCTGTGAA 0: 1
1: 0
2: 0
3: 13
4: 148
Right 997698415 5:135879526-135879548 CTACAGGGATTGGGCATGGCTGG 0: 1
1: 0
2: 0
3: 26
4: 172
997698405_997698408 -8 Left 997698405 5:135879496-135879518 CCACTTTTGGGATGTCCTGTGAA 0: 1
1: 0
2: 0
3: 13
4: 148
Right 997698408 5:135879511-135879533 CCTGTGAAGCCCCTGCTACAGGG 0: 1
1: 0
2: 0
3: 17
4: 235
997698405_997698416 8 Left 997698405 5:135879496-135879518 CCACTTTTGGGATGTCCTGTGAA 0: 1
1: 0
2: 0
3: 13
4: 148
Right 997698416 5:135879527-135879549 TACAGGGATTGGGCATGGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997698405 Original CRISPR TTCACAGGACATCCCAAAAG TGG (reversed) Intronic
909850014 1:80449600-80449622 TTACCATGACATCCCAAAAGAGG - Intergenic
910256306 1:85250461-85250483 TTCCCAGGACATCTCTAAAGGGG + Intronic
911809414 1:102255217-102255239 ATGACAGGAAATCCCAAAATAGG + Intergenic
918149885 1:181789211-181789233 TTCTCAGGAGATGCCACAAGTGG + Intronic
921508030 1:215997612-215997634 TGCACAGCACATCCTAAAAACGG + Intronic
923523614 1:234755804-234755826 TTTCCAGCACATCCCAAAAAGGG + Intergenic
1062832646 10:616490-616512 TTCCCAGGGCATCCCATCAGCGG + Intronic
1065432709 10:25675411-25675433 TGCACAGAACATCCCAAAACGGG + Intergenic
1066787674 10:39023620-39023642 TTCACAGAGCCTCCAAAAAGTGG + Intergenic
1068520273 10:58069892-58069914 TATCCAGGCCATCCCAAAAGTGG - Intergenic
1068795446 10:61074319-61074341 TTAACATGACATTCCAAAAATGG - Intergenic
1072351619 10:94562855-94562877 TTCAGAGGTCATGTCAAAAGAGG + Exonic
1073844476 10:107538110-107538132 CACATAGGACATCCAAAAAGAGG + Intergenic
1074573703 10:114648867-114648889 TACACAGCAGAGCCCAAAAGAGG + Intronic
1074997743 10:118772397-118772419 TTCACAGGGCATCCCTAGTGTGG - Intergenic
1076022925 10:127089252-127089274 TCCACAGGAGAGACCAAAAGAGG - Intronic
1076283393 10:129270698-129270720 TTCTCAGAACATCTCCAAAGGGG - Intergenic
1076621531 10:131792269-131792291 CTCACAGAAGGTCCCAAAAGGGG + Intergenic
1079604951 11:22353843-22353865 CCCCCAGGACATCACAAAAGGGG - Intronic
1085276203 11:75301869-75301891 TTCTCAGGACAGCCCAGGAGGGG + Intronic
1086522134 11:87681201-87681223 TTCTCAGTGCATCCCAAATGAGG + Intergenic
1086875227 11:92087825-92087847 TTTACAGGCCACCACAAAAGGGG + Intergenic
1088432342 11:109772702-109772724 TTCACAGGAAACACAAAAAGTGG + Intergenic
1088809318 11:113379942-113379964 TGAACAGAACATCTCAAAAGAGG - Intronic
1089947316 11:122489669-122489691 CTCACAGGGCATCCAAAAACAGG + Intergenic
1090129554 11:124125664-124125686 TTGAAAGCACATCACAAAAGAGG - Intronic
1091738055 12:2939548-2939570 TTCAGAGATCATTCCAAAAGGGG - Intronic
1093453277 12:19339375-19339397 CTCACAGGCCATACCAAAAGAGG + Intronic
1093728835 12:22544785-22544807 ATCACAGCCCATCCGAAAAGCGG - Intergenic
1095128060 12:38505622-38505644 ATCACAAGACATCTCCAAAGTGG + Intergenic
1095607069 12:44080635-44080657 TTCACAGACCATGCCAAAACAGG - Intronic
1096494934 12:52034297-52034319 TTGCCAGGACATCCAAGAAGTGG - Intronic
1096509916 12:52122024-52122046 TTCTCAGGACCTCCCACTAGAGG - Intergenic
1098086605 12:66851265-66851287 TACACAGGACATCTGGAAAGTGG + Intergenic
1099186240 12:79518318-79518340 GTCCCCTGACATCCCAAAAGGGG + Intergenic
1101825902 12:108219757-108219779 TACCCAGGACAACCCCAAAGGGG + Intronic
1101974213 12:109341251-109341273 TTCACAGCACATTCCAGAAATGG + Intergenic
1103767941 12:123296109-123296131 TTCACAGCAGATTCCAAATGAGG + Intronic
1103848813 12:123917935-123917957 CCCACAGCACATCCCAATAGAGG - Intronic
1109480281 13:62944308-62944330 TTCACAAGACTCCTCAAAAGAGG - Intergenic
1111275864 13:85946097-85946119 TTCCTAGGATATCCCTAAAGGGG - Intergenic
1111332037 13:86771926-86771948 TTCACAGCACATAAAAAAAGAGG - Intergenic
1115844926 14:37518893-37518915 TTCACAAGACATCCCAAATTTGG - Intronic
1116561925 14:46390582-46390604 TTCAAAGGATACCCAAAAAGGGG + Intergenic
1116688924 14:48079990-48080012 TTCACAGAACATCCAGAAAAAGG - Intergenic
1119084501 14:71727614-71727636 TTCAGAGGACATTCGAGAAGGGG - Intronic
1119189228 14:72669020-72669042 TAGACAGAACAACCCAAAAGTGG + Intronic
1119447230 14:74676020-74676042 TCCACAGGACAAGCCAAATGTGG + Intronic
1122362945 14:101178192-101178214 CTCACAGGCCATGCAAAAAGAGG + Intergenic
1202836134 14_GL000009v2_random:78679-78701 TGTACAGGACCTCCCAAATGGGG + Intergenic
1132857574 16:2053678-2053700 TCCCCAGAACATCCCATAAGAGG - Intronic
1133410639 16:5565688-5565710 TTCACAGGTTATCATAAAAGAGG - Intergenic
1135619726 16:23945366-23945388 TTAAAAAGACATCCCAACAGTGG - Intronic
1135685625 16:24496299-24496321 TTCACAGGCCCTTACAAAAGGGG + Intergenic
1135775499 16:25254444-25254466 CTCACAGGCCATCACAGAAGTGG - Intronic
1140648493 16:77061372-77061394 TTCTCAGGATATATCAAAAGTGG + Intergenic
1144709401 17:17390966-17390988 TTCACAGTACATTCCAGAATGGG + Intergenic
1150144949 17:62760898-62760920 TTCACAGGACTTTCCAACACTGG - Intronic
1155167211 18:23240789-23240811 GGAACAGGACATCCCAAAACAGG - Intronic
1157988362 18:52465561-52465583 TTCACAATAGATCCCCAAAGAGG + Intronic
1160084000 18:75757385-75757407 TTAAGATGACATCACAAAAGAGG + Intergenic
1161375316 19:3936889-3936911 CTCACTGGACATCCCTACAGTGG + Intronic
1161899150 19:7104854-7104876 TTCAAAGTACTTCACAAAAGAGG - Intergenic
1168314705 19:55479607-55479629 TTCACAGGACGGCCCCACAGCGG - Intronic
1202636503 1_KI270706v1_random:48683-48705 TGTACAGGACCTCCCAAATGGGG - Intergenic
926782247 2:16484164-16484186 TTCACAGGGCAGGCAAAAAGTGG - Intergenic
927954384 2:27198501-27198523 TTCACAGGACAAAACAAAATAGG + Intergenic
930193405 2:48483502-48483524 TTCACAGGAAACCATAAAAGGGG + Intronic
930443810 2:51445105-51445127 TTCTCCTGACATCCCAAAACTGG - Intergenic
931314024 2:61110107-61110129 TTCATATGAAATCCTAAAAGAGG - Intronic
931324221 2:61201706-61201728 TTGACAAGACAACCCAAAACAGG + Intronic
932083527 2:68737315-68737337 TCCACAGGTCTTCCCAATAGAGG - Intronic
934606306 2:95698106-95698128 TCCACAGGACTTTCCAACAGAGG - Intergenic
938405125 2:131028235-131028257 TTGACACCACATCCCAAATGAGG - Intronic
939994459 2:148907168-148907190 TTCACAGGACAGCAGCAAAGAGG - Intronic
940877033 2:158908267-158908289 TTCACATGACATTCCAAGATTGG - Intergenic
942750852 2:179285335-179285357 CTAACTGGGCATCCCAAAAGGGG + Intergenic
943953402 2:194158059-194158081 TTCACAGAACAGCCCAAAGGAGG - Intergenic
946749149 2:222875768-222875790 TGAACTGGACAACCCAAAAGGGG - Intronic
1169595174 20:7190258-7190280 TTCACAGGAGATCACTCAAGTGG + Intergenic
1169784992 20:9350085-9350107 TTCACAGGACATACAAAATTAGG - Intronic
1172962929 20:38811259-38811281 TTCAGAGGACATCCAAACACAGG + Intronic
1173451104 20:43164874-43164896 TTCACAGGCCATACAAAAACAGG + Intronic
1173982910 20:47238867-47238889 TTCAAACGTCCTCCCAAAAGTGG - Exonic
1175162460 20:57019144-57019166 TGCACAGGACAGCCCCACAGCGG - Intergenic
1175493194 20:59393153-59393175 GTCACAGGACAAAGCAAAAGGGG - Intergenic
1176359990 21:5987240-5987262 TTCACAGCACATCCACAGAGTGG - Intergenic
1176364865 21:6026688-6026710 TGCATAGGACAGCCCAGAAGAGG - Intergenic
1179758653 21:43511857-43511879 TGCATAGGACAGCCCAGAAGAGG + Intergenic
1179763528 21:43551310-43551332 TTCACAGCACATCCACAGAGTGG + Intronic
1180364367 22:11925631-11925653 TGTACAGGACCTCCCAAATGGGG + Intergenic
1185405557 22:50646632-50646654 AAAACAGGACACCCCAAAAGGGG - Intergenic
949638310 3:6008528-6008550 TTCACACGGCATCTAAAAAGAGG - Intergenic
953093340 3:39750907-39750929 ACCACAGGACGTCTCAAAAGTGG + Intergenic
954843838 3:53536604-53536626 TTCACAGGCCATACAAAAAGAGG - Intronic
955073159 3:55588704-55588726 ATTACAGCACATCACAAAAGTGG + Intronic
960227744 3:115186586-115186608 AAAACAGAACATCCCAAAAGGGG - Intergenic
960885214 3:122386838-122386860 TTCACAGGACCTCTCAAATGTGG - Intronic
963139062 3:141932818-141932840 TTCAAATTTCATCCCAAAAGAGG + Intergenic
965726882 3:171727147-171727169 TTCACAGAACATACAAAAACAGG + Intronic
972773155 4:42217366-42217388 TTTACATAACATCCCAAAACAGG + Intergenic
973394296 4:49580383-49580405 TGTACAGGACCTCCCAAATGGGG + Intergenic
981326901 4:143459592-143459614 TTCACAGAACCCCCAAAAAGGGG - Intronic
1202763819 4_GL000008v2_random:134553-134575 TGTACAGGACCTCCCAAATGGGG - Intergenic
988019922 5:25609103-25609125 ATCTCAGGTCACCCCAAAAGTGG - Intergenic
989823509 5:45825129-45825151 TGAGCAGGAAATCCCAAAAGAGG - Intergenic
992175820 5:74147692-74147714 TCCACAAGACATCTCAAAACAGG + Intergenic
992722495 5:79574571-79574593 GACAGAGGACCTCCCAAAAGGGG + Intergenic
994244453 5:97463723-97463745 CTAATAGGACAGCCCAAAAGTGG - Intergenic
995758560 5:115539549-115539571 TTCCCATGGCATTCCAAAAGGGG - Intronic
995846425 5:116498933-116498955 TAAACAGGCCATGCCAAAAGGGG - Intronic
997698405 5:135879496-135879518 TTCACAGGACATCCCAAAAGTGG - Intronic
1000370419 5:160530040-160530062 TTTACAGGAGATACCAAAAATGG - Intergenic
1000924487 5:167177341-167177363 GTCACAGGACATCTTTAAAGAGG - Intergenic
1002703576 5:181144666-181144688 TAAACAGAACACCCCAAAAGGGG - Intergenic
1003844051 6:10154417-10154439 CTCACAGGCCATACAAAAAGAGG + Intronic
1003935678 6:10972974-10972996 GTCACAGCACTCCCCAAAAGTGG + Intronic
1005136209 6:22571114-22571136 TTCCCAGGGCATCCCATCAGTGG - Exonic
1011939634 6:92826713-92826735 TAAACAGAACACCCCAAAAGTGG - Intergenic
1013260633 6:108437942-108437964 TTCACAGTGCATCCAAAAAGAGG - Intronic
1013570396 6:111418413-111418435 TTCACAGGAGATGTGAAAAGTGG - Intronic
1017949389 6:159123289-159123311 TACACAGGCCATCCCACTAGAGG - Intergenic
1021689787 7:23220912-23220934 CTCACAGGACATCTCAAGAGAGG + Intergenic
1023083384 7:36546418-36546440 TCCACAGGACATCACAAAGTGGG + Intronic
1023470692 7:40514941-40514963 TTCACAGAATATCCTGAAAGTGG + Intronic
1026403922 7:70044432-70044454 TCCCCAGGCCATCCCAAAAAAGG - Intronic
1028113289 7:86968405-86968427 TTCGAAGGACATACCAAAACAGG + Intronic
1030352607 7:108506750-108506772 TTCATAGAACATGCAAAAAGAGG + Intronic
1030956769 7:115862769-115862791 TTCCCTAGGCATCCCAAAAGTGG + Intergenic
1033321698 7:140345723-140345745 TTCACAGGACAATGCAAAGGTGG + Intronic
1034850616 7:154489972-154489994 TACACAGGACAACCCAAAGAAGG + Intronic
1034861816 7:154602217-154602239 TTTACACGATATACCAAAAGTGG - Intronic
1036226614 8:6964296-6964318 TTCACATGAAATCCCAAAGGAGG + Intergenic
1036228249 8:6978505-6978527 TGCAGCGGACATCCCAGAAGTGG - Exonic
1036230702 8:6997622-6997644 TGCAGCGGACATCCCAGAAGTGG - Exonic
1036233148 8:7016721-7016743 TGCAGCGGACATCCCAGAAGTGG - Exonic
1037235555 8:16715552-16715574 TCCACAGGGCTTCACAAAAGGGG + Intergenic
1037269724 8:17113436-17113458 TACACATGACATTCCAGAAGAGG + Intronic
1037554515 8:20009238-20009260 TTCACAGGAAATCCCCTATGAGG + Intergenic
1038089145 8:24234360-24234382 TTCACAGGTCATTCTAAAACAGG - Intergenic
1038699659 8:29837518-29837540 TGAAGAGGGCATCCCAAAAGGGG + Intergenic
1040138974 8:43888135-43888157 TTCACAAGATCTCCAAAAAGAGG - Intergenic
1041003294 8:53472742-53472764 TGCAAAAGACATCCCCAAAGAGG - Intergenic
1041891019 8:62869060-62869082 TTCAGAGGACATGCCAACAAAGG - Intronic
1042606331 8:70550346-70550368 TTCACATGAAATCCACAAAGTGG - Intergenic
1051335858 9:16065332-16065354 TTCCCAGAACGTCCCAGAAGTGG - Intergenic
1054812595 9:69446786-69446808 TCCTCAGGACAGCCCACAAGGGG - Intronic
1055807087 9:80107966-80107988 CTAAAAGGACATCCTAAAAGTGG - Intergenic
1058460226 9:105175641-105175663 TTGTCAGGACATCCCACAAGGGG + Intergenic
1058556649 9:106175796-106175818 TTCAAAGGAAATGCCAAAACTGG + Intergenic
1203544571 Un_KI270743v1:119426-119448 TGTACAGGACCTCCCAAATGGGG - Intergenic
1187912618 X:24124907-24124929 TTCCCAGCACAACCTAAAAGTGG + Intergenic
1189625755 X:42895217-42895239 TTCATAAGACAGTCCAAAAGAGG + Intergenic
1191846097 X:65549399-65549421 TGGCCAGGACATTCCAAAAGAGG + Intergenic
1194710859 X:97234766-97234788 TTCACAGGCCATACGAAAACAGG + Intronic
1196382674 X:115109148-115109170 AACACAGAACACCCCAAAAGGGG + Intergenic
1196689521 X:118544491-118544513 TTCAGAGCACTTTCCAAAAGAGG + Intronic
1197042685 X:121958431-121958453 CAAACAGAACATCCCAAAAGGGG - Intergenic
1199103304 X:143832340-143832362 TTCACAGGACAGACAAAAAGAGG + Intergenic
1199321791 X:146448087-146448109 AAAACAGGACACCCCAAAAGGGG + Intergenic
1199343585 X:146711541-146711563 TTCATATGACATTCCATAAGTGG + Intergenic
1201464962 Y:14270268-14270290 GTCTCAGGACTTCCCAGAAGGGG + Intergenic