ID: 997699302

View in Genome Browser
Species Human (GRCh38)
Location 5:135885266-135885288
Sequence GCCCATTGTATGCCTGGCAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 264
Summary {0: 1, 1: 2, 2: 1, 3: 23, 4: 237}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997699302_997699309 27 Left 997699302 5:135885266-135885288 CCAGTGCCAGGCATACAATGGGC 0: 1
1: 2
2: 1
3: 23
4: 237
Right 997699309 5:135885316-135885338 AGTGATCCCACAAGCCTGCTGGG 0: 1
1: 0
2: 0
3: 18
4: 158
997699302_997699305 -2 Left 997699302 5:135885266-135885288 CCAGTGCCAGGCATACAATGGGC 0: 1
1: 2
2: 1
3: 23
4: 237
Right 997699305 5:135885287-135885309 GCATTTAAATGTTGCTGAAAGGG 0: 1
1: 0
2: 2
3: 29
4: 271
997699302_997699304 -3 Left 997699302 5:135885266-135885288 CCAGTGCCAGGCATACAATGGGC 0: 1
1: 2
2: 1
3: 23
4: 237
Right 997699304 5:135885286-135885308 GGCATTTAAATGTTGCTGAAAGG 0: 1
1: 0
2: 1
3: 14
4: 185
997699302_997699308 26 Left 997699302 5:135885266-135885288 CCAGTGCCAGGCATACAATGGGC 0: 1
1: 2
2: 1
3: 23
4: 237
Right 997699308 5:135885315-135885337 AAGTGATCCCACAAGCCTGCTGG 0: 1
1: 0
2: 1
3: 7
4: 102

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997699302 Original CRISPR GCCCATTGTATGCCTGGCAC TGG (reversed) Intronic
900694351 1:4000661-4000683 GACCATTGAGTGCCGGGCACTGG + Intergenic
903500487 1:23797691-23797713 TCACCTTGTCTGCCTGGCACAGG + Exonic
904322141 1:29704689-29704711 GCTCACTGAGTGCCTGGCACTGG + Intergenic
904450899 1:30610785-30610807 GCCCACTATGGGCCTGGCACTGG - Intergenic
905105387 1:35560691-35560713 GCCCCAGGTATGCCTGGCATAGG - Exonic
905851495 1:41278147-41278169 GCCCGTGATATGCCAGGCACTGG - Intergenic
906095983 1:43224344-43224366 GCCTGTTGTGTGCTTGGCACTGG + Intronic
909573258 1:77142295-77142317 GCTCATTGTATCTCTTGCACTGG + Intronic
910936589 1:92487747-92487769 CCCTATTGTATGCCAGGCGCTGG + Intergenic
911181068 1:94860911-94860933 GCCCATTGTCTACCTTGGACTGG - Intronic
912584346 1:110748839-110748861 CACCATTGTATTCCTGGCCCTGG - Intergenic
912883084 1:113438301-113438323 CCCCATTGGATGCCTGAAACTGG + Intronic
914991732 1:152504855-152504877 GCACATGGTATACCTGCCACTGG + Intergenic
915285397 1:154848931-154848953 GCCCATTCTGTGGCAGGCACTGG - Intronic
916282425 1:163066544-163066566 GCCCATTTTATTCATGGTACAGG + Intergenic
919420410 1:197363753-197363775 GCCCTTTCCATGCCTGGCAACGG + Intronic
921153554 1:212420479-212420501 GCTCACTGTATGCCAGGTACTGG - Intergenic
922460194 1:225809973-225809995 GCCCGTTTTATCCCTGGCAGAGG + Intergenic
924115696 1:240744045-240744067 TTACAGTGTATGCCTGGCACTGG - Intergenic
1063391619 10:5653231-5653253 GCCCCTTGTAGGCCTTGCCCAGG - Intronic
1064337108 10:14453569-14453591 GCCCATGATATGCCAGGCACGGG - Intronic
1066123333 10:32313324-32313346 AACCATTATGTGCCTGGCACTGG + Intronic
1072089172 10:92110213-92110235 GGCCTTTGTATGACTAGCACTGG - Intronic
1072207294 10:93215604-93215626 GCCCATTGTCACCCTGGCCCTGG + Intergenic
1073152418 10:101321161-101321183 GCCCTCTGAAGGCCTGGCACAGG - Intergenic
1073559597 10:104485589-104485611 GCCAAGACTATGCCTGGCACAGG + Intergenic
1073582975 10:104684462-104684484 ACCCACTGTGTGCCCGGCACGGG + Intronic
1074320122 10:112393945-112393967 ACTCACTGTATGCCAGGCACAGG - Intronic
1075244039 10:120804641-120804663 ACCCACTGTATGCCAGGCCCTGG + Intergenic
1076599652 10:131648886-131648908 GCCCAGTGTGTGGCTGGCAGTGG - Intergenic
1077997232 11:7464565-7464587 ACTTATTGTATGCCAGGCACTGG - Intronic
1078565483 11:12410455-12410477 CCTGAATGTATGCCTGGCACAGG - Intronic
1079831157 11:25269866-25269888 GCCCATTATGTGACTGGCTCTGG + Intergenic
1081749555 11:45500160-45500182 GCCCTTTCTAGGCCTGACACTGG + Intergenic
1083266074 11:61547399-61547421 GCCCACTGTGTGCCCGGCCCCGG - Intronic
1083945472 11:65920469-65920491 CCCCACTGTATGCCAGGCCCTGG - Intronic
1084195393 11:67521650-67521672 GCCCACTGTGTGCCTGGCCCTGG - Intronic
1084380027 11:68805865-68805887 GCCCATTGTAGTCATGGCCCTGG - Intronic
1085154853 11:74284024-74284046 GCCCACTGTGTGCCAGACACTGG - Intronic
1086229630 11:84552693-84552715 ACCCACTGAATACCTGGCACAGG - Intronic
1088640760 11:111871089-111871111 GCCCACTCTAGGCCTGGCCCAGG + Intronic
1089169004 11:116499671-116499693 GCCCCTTGCATGCCCTGCACAGG - Intergenic
1089528434 11:119111740-119111762 TCCTATTGTATGCCAGGCCCTGG + Intronic
1089535074 11:119156100-119156122 ACCTGTTGTATGCCAGGCACTGG - Intronic
1089752943 11:120664440-120664462 TCCCATTCTTTGCCTGGCACTGG + Intronic
1089767341 11:120777489-120777511 GCCCACTGTGTGCCCGGCACGGG + Intronic
1089984173 11:122797445-122797467 GCCCATTCCATTACTGGCACGGG + Intronic
1090135281 11:124191504-124191526 GCCCACTCTATTCTTGGCACTGG - Intergenic
1091108165 11:132942561-132942583 GCCCCTTGGATGGCTGTCACAGG - Intronic
1092917775 12:13203651-13203673 CCCCACTCTGTGCCTGGCACAGG + Intronic
1095585007 12:43839752-43839774 GCCTATTTTTTGCCAGGCACTGG - Intronic
1096491129 12:52013667-52013689 CCCCCTTGTCTGCCTGGCAGGGG + Exonic
1096806630 12:54144937-54144959 GCCCACTGCGTGCTTGGCACTGG + Intergenic
1099847625 12:88048141-88048163 GCCCACTGTCTGCCAGGTACTGG - Intronic
1100308901 12:93376905-93376927 GCCTATTGTGTGTCAGGCACTGG - Intergenic
1101569007 12:105936033-105936055 GCCCACTGTGTCCCAGGCACTGG + Intergenic
1102734236 12:115143948-115143970 GCCTACTGTGTGCCTGGCTCAGG - Intergenic
1102815940 12:115866594-115866616 GCCCTTACTATGCCAGGCACTGG + Intergenic
1102959645 12:117084517-117084539 GCGCATTGCCTGCCTGGCCCTGG + Intronic
1106229029 13:27807593-27807615 GCCCACTGTGTGCCAGGCCCTGG - Intergenic
1106692805 13:32136709-32136731 GCCCAGTGGATGCAGGGCACTGG - Intronic
1107041387 13:35951594-35951616 GCCCATTATTTGCCAGTCACTGG + Intronic
1107928983 13:45290855-45290877 GCCCACTGTGTGCCAGGCACAGG + Intergenic
1108238718 13:48438036-48438058 GTCCATTATATGCTTGGCACTGG + Intronic
1110483283 13:76008357-76008379 AACTATTGTATGCCAGGCACTGG - Intergenic
1110549481 13:76796201-76796223 GCACATTGTAGGCCTGGGAATGG - Intergenic
1111957929 13:94778752-94778774 GCCCATTATTTGCCAGGCACTGG + Intergenic
1114990018 14:28274717-28274739 GCCCATTGAATTCCTGTAACGGG + Intergenic
1115963677 14:38863623-38863645 CCCCATTGTAAGCCTGGGGCGGG - Intergenic
1117191251 14:53293943-53293965 GCCCCCTAAATGCCTGGCACAGG + Intergenic
1117553670 14:56862395-56862417 GCCCACTGTGTGCCAGGCACAGG + Intergenic
1119047476 14:71332240-71332262 TCCCATTATATGCCAGGGACTGG + Intronic
1119130935 14:72172723-72172745 GCCAATTGTGTGCCAGGCAGTGG + Intronic
1121229427 14:92345799-92345821 ACCCCCTGTATGCCAGGCACTGG + Intronic
1123881252 15:24678820-24678842 GCCACTGGGATGCCTGGCACTGG + Exonic
1125735771 15:41924563-41924585 CCCCCCTGTATGCCAGGCACTGG - Intronic
1126495571 15:49286373-49286395 ACCTATTGTATGCTTAGCACTGG + Intronic
1126988858 15:54346863-54346885 CCCTATTATATGCCAGGCACTGG + Intronic
1127759132 15:62120931-62120953 GCCCATTGTTTGGCAAGCACAGG + Intergenic
1130680174 15:85989748-85989770 GCCTACTGTATGCATGGCACTGG + Intergenic
1130926500 15:88389537-88389559 GCCCACTGTGTTCCAGGCACTGG - Intergenic
1132634737 16:938222-938244 GGCCATGGCCTGCCTGGCACAGG + Intronic
1136450540 16:30352126-30352148 CCCCACTATGTGCCTGGCACAGG - Exonic
1137035589 16:35566946-35566968 GCCCACTGTAGGCAGGGCACAGG + Intergenic
1137254405 16:46763285-46763307 GACCATTGTTTCCCTGGCAATGG + Intronic
1137484616 16:48881092-48881114 ACCCACTGTATGCCTGACACGGG - Intergenic
1137611081 16:49818049-49818071 GACCATGGCAGGCCTGGCACTGG - Intronic
1138130346 16:54474048-54474070 GCCTACTGTATGACTGGCACTGG + Intergenic
1138297408 16:55898861-55898883 GACCACTGTGTGTCTGGCACTGG + Intronic
1138528984 16:57624858-57624880 GCCCATTGTCTGCCAGGCCTGGG + Intronic
1139043764 16:63032028-63032050 GACCTGTGTATGCCTGGCATTGG - Intergenic
1141476335 16:84276026-84276048 GCCCACGGTGTGCCAGGCACCGG + Intergenic
1141517741 16:84557629-84557651 TCCCACTGTTTGCCAGGCACTGG + Intergenic
1141943378 16:87293531-87293553 GCTCAATCTGTGCCTGGCACTGG + Intronic
1142799992 17:2338622-2338644 GCCTACAGTATGCCAGGCACTGG - Intronic
1145261691 17:21358394-21358416 GCTCACTGTATGCCAGGCCCTGG + Intergenic
1146623445 17:34418348-34418370 CCCGATTGGATGCCTGGCAGAGG - Intergenic
1147891717 17:43721980-43722002 GCCCATTATGTGCCAGGCAGAGG + Intergenic
1147917707 17:43898536-43898558 GGCCCTTGAATGCCTGGGACAGG + Intronic
1151024977 17:70668061-70668083 GCCTACTGTATGCCTGGGACAGG - Intergenic
1151238757 17:72741524-72741546 GCCCTTTGTATGCTAGACACTGG - Intronic
1152730900 17:81969419-81969441 GCCCACTGAATGCCCAGCACAGG - Intergenic
1153699975 18:7683129-7683151 GCCCATGAAATCCCTGGCACTGG + Intronic
1154264671 18:12869974-12869996 GCCCTTAATATGCCTGCCACTGG + Intronic
1155170919 18:23266329-23266351 GCCTACTGTATGCCAGGCCCTGG - Intronic
1157221971 18:45834712-45834734 CCCCACTTTATGCCAGGCACTGG - Intronic
1158176202 18:54658986-54659008 GCTCATTGTGTGCCTGGCACAGG - Intergenic
1160173366 18:76572735-76572757 GCCCTGTGTATGCCTAGCTCTGG - Intergenic
1160737810 19:672291-672313 GCCCACTGTGTGCCAGGCCCTGG - Intergenic
1161282921 19:3455400-3455422 GTCTACTGTATGCCAGGCACTGG - Intronic
1161313392 19:3607030-3607052 GGCCATTGCATCCCTGCCACCGG - Intergenic
1161607293 19:5222262-5222284 GCCCCATGAGTGCCTGGCACTGG + Intronic
1163137179 19:15320715-15320737 GCTCCTTCTATGCCTGACACAGG + Intronic
1163369188 19:16892575-16892597 GCCGGTTGTAAGCCTTGCACGGG + Exonic
1163626022 19:18390238-18390260 GCCCACTTTATGCCAGGCCCCGG + Intergenic
1164899831 19:31909070-31909092 GCCCACTGTGTGTCTGGCCCTGG - Intergenic
1165118662 19:33545120-33545142 GCTCATGGAATTCCTGGCACTGG + Intergenic
1165428924 19:35760772-35760794 GCCCAATTTAGGCCTGGCAGTGG - Intronic
925902981 2:8521746-8521768 GCCCCTTGTCTCCCTGCCACAGG - Intergenic
926166305 2:10523679-10523701 GCCCACTGTGTGCCCAGCACAGG - Intergenic
926799855 2:16650705-16650727 GCCCATTACATGCCTGCAACCGG + Intronic
927186380 2:20485434-20485456 GCCCGTGGTGGGCCTGGCACTGG + Intergenic
927859202 2:26549982-26550004 ACCCATTCTGTGCCAGGCACTGG + Intronic
928229453 2:29484116-29484138 GCCCACTGGATGCCTCCCACGGG + Intronic
929561575 2:42959672-42959694 GCCCATTGTTTGCCTGCCCTGGG + Intergenic
929945327 2:46367150-46367172 GCCCATTGTATGCCTTTGAATGG + Intronic
929992421 2:46801312-46801334 ACACATTGTGTGCCAGGCACTGG - Intergenic
930241095 2:48936433-48936455 GCCTATTGTAATTCTGGCACTGG + Intergenic
931265956 2:60660667-60660689 GCCCATTGTCTCCCGGGCACAGG - Intergenic
935744470 2:106178720-106178742 CCCTAGTGGATGCCTGGCACTGG + Intronic
937390951 2:121485823-121485845 GCCCGTCCTGTGCCTGGCACTGG + Intronic
937670240 2:124530671-124530693 GCCCATGGACTGCCAGGCACTGG - Intronic
938296360 2:130181954-130181976 GCCCAATGTATGCCTGGCACTGG + Exonic
938460389 2:131492684-131492706 GCCCAATGTATGCCTGGCACTGG - Intronic
938566766 2:132525689-132525711 GCTCACTGTGTGCCAGGCACAGG + Intronic
939488088 2:142842211-142842233 GCCTATTATATGCTTGGCACTGG + Intergenic
944098052 2:195992576-195992598 GCCTACTGTGTGCCTGCCACTGG + Intronic
944318314 2:198307113-198307135 GCCCACTGTGTGCCAGGCACTGG + Intronic
945974581 2:216260256-216260278 GCCTATTGTGTGCCAAGCACTGG + Intronic
945995448 2:216432387-216432409 GCCCACTGTAGGCAGGGCACAGG - Intronic
947400869 2:229730441-229730463 GCCTATTGTGGGCCAGGCACTGG + Intergenic
948412506 2:237775028-237775050 ACCCGTTGCATGCCGGGCACGGG + Intronic
949047753 2:241879870-241879892 GGCCATAGGATGCCTGGCCCTGG - Intergenic
1169026824 20:2378888-2378910 ACCCACTTTATGCCTGGCATTGG + Intergenic
1169895326 20:10499565-10499587 CCCATTTGTATTCCTGGCACAGG + Intronic
1171460892 20:25297381-25297403 GCCCATTTTCTGCCTGGCAGGGG + Exonic
1172629442 20:36368096-36368118 ACCCACTGTATGCCAGGCACGGG - Intronic
1172941118 20:38655493-38655515 ACCTACTGTGTGCCTGGCACTGG + Intergenic
1173175751 20:40763531-40763553 GCCCAATGTGTGGCTGGCTCAGG - Intergenic
1173413539 20:42836677-42836699 GGCCACTGAATTCCTGGCACTGG + Intronic
1174747327 20:53076401-53076423 CCCTATTGTGTGCCAGGCACTGG + Intronic
1176138274 20:63534520-63534542 GGCCACTGGCTGCCTGGCACGGG - Intronic
1177867852 21:26534509-26534531 GCCCAATGAAAGCCTGGCACAGG + Intronic
1178195753 21:30343926-30343948 CCCCATTGCATGCCTTGCAAGGG - Intergenic
1178748150 21:35273603-35273625 GCCAAATGTATGCCTGGCCTGGG - Intronic
1179265564 21:39799364-39799386 ACCCAGTGTGTTCCTGGCACAGG - Intronic
1181876603 22:25945416-25945438 GCCCATTCAGTGCCAGGCACTGG - Intronic
1182129687 22:27841930-27841952 GTCCACTGTGTGCCAGGCACTGG + Intergenic
1182237974 22:28891492-28891514 GCTTATTGTGTGCCAGGCACTGG + Intronic
1182471254 22:30549719-30549741 GCCTACTGTGTGCCAGGCACTGG + Intergenic
1184032523 22:41903356-41903378 GCCTGCTGTATGCCTGGCCCTGG + Intronic
1184292159 22:43503160-43503182 ACCTATTGTATGCCAGGCCCTGG - Intronic
949270106 3:2205616-2205638 GGCCATTCTGTGCCTGTCACTGG - Intronic
950651395 3:14409575-14409597 GCCTACTGTGTGCCAGGCACAGG + Intronic
950738825 3:15033383-15033405 GTCCCTTGCATGCCAGGCACTGG - Intronic
951745815 3:25976194-25976216 GCCTTCTGTGTGCCTGGCACTGG + Intergenic
953515383 3:43586064-43586086 GCCCTTTGTGTGCTTGGCCCAGG - Intronic
954321368 3:49834078-49834100 GCCCATTGCCTGCGTGGCATGGG + Intronic
954464734 3:50647756-50647778 GCCCACTGTGTGCCCAGCACTGG - Intronic
955317975 3:57954483-57954505 GACCATTGTTTGCCTGGAGCTGG + Intergenic
955585942 3:60478107-60478129 GCTCATAATATGCCAGGCACTGG + Intronic
956297665 3:67731696-67731718 TCCCTTTTTATGCCTGGCATGGG - Intergenic
956631227 3:71318304-71318326 GCCTCTTGTATGCCTGTCACTGG - Intronic
957671329 3:83306141-83306163 GCCTATTGTCTGCCTAGCAATGG - Intergenic
959808261 3:110585083-110585105 GCTTACTCTATGCCTGGCACTGG - Intergenic
961559626 3:127719520-127719542 GCACAGTGCATGCCTGGCATTGG + Intronic
962903954 3:139785048-139785070 GCCCACTGCATGGCAGGCACTGG - Intergenic
962933748 3:140060604-140060626 GCCCAGTGGATACCTGGCTCAGG + Intronic
963933904 3:151033488-151033510 TCCCCGTGAATGCCTGGCACAGG - Intergenic
964423993 3:156533044-156533066 GCCTATTGTATACCAGGTACTGG + Intronic
964682404 3:159356851-159356873 GCCCCTTTTATGCCTTGCAGAGG + Intronic
964686467 3:159401444-159401466 TCTCGTTATATGCCTGGCACAGG + Intronic
967278032 3:187795622-187795644 TCCTTTTGTAAGCCTGGCACGGG + Intergenic
967581203 3:191157046-191157068 GCCTACTGTATGCATGGAACTGG - Intergenic
968910180 4:3473539-3473561 GGCCATTGTCTGCCTGTCCCAGG + Exonic
969480978 4:7446692-7446714 CCCCCTTGTATGCCAGGAACAGG - Intronic
969573526 4:8023868-8023890 GCCCAGTGTGTGCCTGGTGCTGG + Intronic
971128601 4:23781111-23781133 ATCCTTTCTATGCCTGGCACAGG + Intronic
975387500 4:73774206-73774228 GACCATGGTCTGCCTGGCAACGG + Intergenic
976282145 4:83335699-83335721 GCCTACTGTATGCCTGATACAGG + Intergenic
979297516 4:119050587-119050609 GCTTATTGTATGCCAGGCAGTGG - Intronic
980822478 4:138035875-138035897 TCTCACTGGATGCCTGGCACTGG - Intergenic
982232040 4:153218168-153218190 GCATATTGTATGTCTGGCAATGG + Intronic
983090144 4:163493685-163493707 GCCTACTGTGTGCCTGGTACTGG - Intergenic
983505040 4:168544305-168544327 ACCTATTATATGCCTGGCATAGG + Intronic
985624847 5:979967-979989 GCCCACTGTATACCAGGCACTGG - Intronic
991269874 5:64767423-64767445 GCCTACTGTGTGCCAGGCACTGG - Intronic
992844099 5:80727668-80727690 GCCTATTATATGCCAGGCATTGG + Intronic
993339185 5:86701688-86701710 GCCTATTGTATACCAGGCATTGG + Intergenic
997331420 5:133065109-133065131 GCCCATTATGTGCCTAACACTGG + Intronic
997415022 5:133720996-133721018 GCCCACTCTTTGCCTGCCACTGG + Intergenic
997699302 5:135885266-135885288 GCCCATTGTATGCCTGGCACTGG - Intronic
998524802 5:142832585-142832607 GTCTTTTGTGTGCCTGGCACAGG + Intronic
998611589 5:143695031-143695053 GACAATTGCATGCCTGGCTCTGG - Intergenic
999088778 5:148916683-148916705 GCCTCCTGTATGCCAGGCACTGG + Intergenic
999743755 5:154576383-154576405 GCCTACTGTGTGCCAGGCACTGG - Intergenic
1000116929 5:158162205-158162227 GGCCACTTTGTGCCTGGCACTGG - Intergenic
1002313882 5:178331042-178331064 TCCTACTGTATGCCAGGCACTGG - Intronic
1003226263 6:4208588-4208610 GCCTACTCTATGCCAGGCACTGG - Intergenic
1003866242 6:10365589-10365611 GCCCATTCTATTCTTGGCAGTGG + Intergenic
1004065398 6:12239064-12239086 GCCCACTGTGTGCCAGGAACTGG - Intergenic
1007467793 6:42066944-42066966 GCCCGCTGTGTGCCTGGCTCTGG + Intronic
1007486903 6:42186734-42186756 GCCTATTTTATGCTGGGCACTGG - Intronic
1008966136 6:57314579-57314601 GCCCATGGAGTGCCAGGCACTGG + Intergenic
1010190562 6:73191602-73191624 GCCCATTATATGCCTCACACTGG - Intronic
1010436906 6:75842097-75842119 GCCCATTGGGTGCCAGGCATTGG + Intronic
1014310342 6:119792168-119792190 GTCCAGTTTATGCCTGGCTCTGG - Intergenic
1016407139 6:143742535-143742557 GCCCAGTTTCTCCCTGGCACTGG - Intronic
1016629980 6:146217614-146217636 GCCTACTGTGTGCCAGGCACTGG + Intronic
1016862803 6:148737556-148737578 GCCCAACGTGTGCCTGGCCCGGG - Intergenic
1018315751 6:162554742-162554764 TCCCAATGTACGCCTGGCTCCGG - Intronic
1019895519 7:3979476-3979498 TCCTACTGTATACCTGGCACTGG - Intronic
1020432184 7:8125707-8125729 TCCCACTGTGTGCCAGGCACTGG - Intronic
1025744094 7:64227691-64227713 GCCCACTGTAGGCAGGGCACAGG + Intronic
1027202355 7:76072036-76072058 GCCCATCGCATGCCTCTCACTGG - Intergenic
1027404558 7:77846286-77846308 CCCCATTCTATGCCAGTCACTGG - Intronic
1027467479 7:78534051-78534073 GCCTATTATTTGCCAGGCACAGG + Intronic
1030350340 7:108477929-108477951 GCCTACTATATGCCAGGCACTGG + Intronic
1030585711 7:111416253-111416275 ATTCATTGTATGCCTAGCACGGG - Intronic
1030670903 7:112335715-112335737 ACCCACTGTATGCCAGGCTCTGG + Intronic
1030685917 7:112487005-112487027 GCTGATTGTCAGCCTGGCACTGG + Exonic
1031979384 7:128114961-128114983 CCCCACTGTGTGCCAGGCACTGG - Intergenic
1032253569 7:130278911-130278933 GTCCATTGTAGGCCTGGCCAGGG - Intronic
1033649264 7:143328453-143328475 GCACATTTTATGTCTGGCTCAGG + Intronic
1033788791 7:144766753-144766775 GCCAATTGTATACCAGGCACTGG + Intronic
1034558632 7:151865539-151865561 GCCTGTTGTGTGCCAGGCACAGG - Intronic
1035388719 7:158490931-158490953 GCCCTCTGTGTGTCTGGCACAGG + Intronic
1038246305 8:25859511-25859533 ACCCAGTCTATGCCTGGGACGGG + Intronic
1039788034 8:40850572-40850594 GCCTATTGTGTGCCTGTCAGTGG - Intronic
1039919009 8:41880063-41880085 GCCCATTTTTTGCATAGCACGGG + Intronic
1042411205 8:68467945-68467967 GCCCATTAAATGTCGGGCACAGG - Intronic
1044991493 8:97800380-97800402 GGCTATTGTATGCCAGTCACCGG + Intronic
1045387983 8:101689653-101689675 GCCCACTGTGTGCCCGGCCCTGG + Intronic
1046577919 8:116054948-116054970 GCACCTATTATGCCTGGCACTGG - Intergenic
1046800567 8:118422195-118422217 GCCTACTTTATGCCAGGCACTGG + Intronic
1049045478 8:140148002-140148024 TCCCACTGTGTGCCAGGCACTGG + Intronic
1049681110 8:143918706-143918728 GCTCAGTGTCTGCCTGGAACCGG + Exonic
1049731542 8:144180950-144180972 GCCCTCTGTGTGCCTGGCAGGGG + Intronic
1051495014 9:17710855-17710877 CCCCAATGTATGCCTGAAACTGG + Intronic
1051685571 9:19654807-19654829 GCCATTTAAATGCCTGGCACAGG + Intronic
1055324768 9:75118018-75118040 GCCTATTATATGCCAGACACTGG + Intronic
1057841581 9:98489801-98489823 GCCCCTGTTATGCTTGGCACAGG + Intronic
1059774710 9:117463552-117463574 ACCCACTGTGTGCCAGGCACTGG + Intergenic
1060205546 9:121680684-121680706 GCCTACTGTGTGCCAGGCACTGG + Intronic
1061609898 9:131739583-131739605 GCCCATTGCCTGCCGGGCGCGGG - Intronic
1187411884 X:19058177-19058199 GCCTACTGTGTGCCAGGCACGGG + Intronic
1191665740 X:63700766-63700788 GCCCATTGAAGGCCTGTCACAGG + Intronic
1194192752 X:90857700-90857722 GCCCTTTGTGTGCCAGGCCCAGG + Intergenic
1194970300 X:100335744-100335766 GCCCACTATGTGCCTGGCTCTGG - Intronic
1195674706 X:107499056-107499078 GTTCACTGTATCCCTGGCACAGG - Intergenic
1197720429 X:129741121-129741143 GCCTACTGTGTGCCAGGCACTGG - Intronic
1198139172 X:133785597-133785619 GCCTATTGTGTGCCAGGTACTGG + Intronic
1200229115 X:154435297-154435319 ACCCAGTGTCTGCCCGGCACTGG + Exonic
1200539380 Y:4440149-4440171 GCCCTTTGTGTGCCAGGCCCAGG + Intergenic