ID: 997700992

View in Genome Browser
Species Human (GRCh38)
Location 5:135899334-135899356
Sequence CTAAATAACCAGATGGGGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997700992_997700999 -2 Left 997700992 5:135899334-135899356 CCTTTCCCCATCTGGTTATTTAG No data
Right 997700999 5:135899355-135899377 AGGTCAGGTATCTGTACAGAGGG No data
997700992_997701004 11 Left 997700992 5:135899334-135899356 CCTTTCCCCATCTGGTTATTTAG No data
Right 997701004 5:135899368-135899390 GTACAGAGGGAAGGGAGCAGGGG No data
997700992_997701002 9 Left 997700992 5:135899334-135899356 CCTTTCCCCATCTGGTTATTTAG No data
Right 997701002 5:135899366-135899388 CTGTACAGAGGGAAGGGAGCAGG No data
997700992_997701003 10 Left 997700992 5:135899334-135899356 CCTTTCCCCATCTGGTTATTTAG No data
Right 997701003 5:135899367-135899389 TGTACAGAGGGAAGGGAGCAGGG No data
997700992_997701006 18 Left 997700992 5:135899334-135899356 CCTTTCCCCATCTGGTTATTTAG No data
Right 997701006 5:135899375-135899397 GGGAAGGGAGCAGGGGACCTGGG No data
997700992_997700998 -3 Left 997700992 5:135899334-135899356 CCTTTCCCCATCTGGTTATTTAG No data
Right 997700998 5:135899354-135899376 TAGGTCAGGTATCTGTACAGAGG No data
997700992_997701000 2 Left 997700992 5:135899334-135899356 CCTTTCCCCATCTGGTTATTTAG No data
Right 997701000 5:135899359-135899381 CAGGTATCTGTACAGAGGGAAGG No data
997700992_997701005 17 Left 997700992 5:135899334-135899356 CCTTTCCCCATCTGGTTATTTAG No data
Right 997701005 5:135899374-135899396 AGGGAAGGGAGCAGGGGACCTGG No data
997700992_997701001 3 Left 997700992 5:135899334-135899356 CCTTTCCCCATCTGGTTATTTAG No data
Right 997701001 5:135899360-135899382 AGGTATCTGTACAGAGGGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997700992 Original CRISPR CTAAATAACCAGATGGGGAA AGG (reversed) Intergenic
No off target data available for this crispr