ID: 997702830

View in Genome Browser
Species Human (GRCh38)
Location 5:135916363-135916385
Sequence AGTTATATGCTGAAGATGGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997702828_997702830 10 Left 997702828 5:135916330-135916352 CCATGGAGCAGAGTTCATTTTAA No data
Right 997702830 5:135916363-135916385 AGTTATATGCTGAAGATGGTTGG No data
997702827_997702830 11 Left 997702827 5:135916329-135916351 CCCATGGAGCAGAGTTCATTTTA No data
Right 997702830 5:135916363-135916385 AGTTATATGCTGAAGATGGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997702830 Original CRISPR AGTTATATGCTGAAGATGGT TGG Intergenic
No off target data available for this crispr