ID: 997704653

View in Genome Browser
Species Human (GRCh38)
Location 5:135936759-135936781
Sequence GTAACTTCCTTTACTAGATC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 237
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 221}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997704651_997704653 1 Left 997704651 5:135936735-135936757 CCATGTAGTATTACAAATTTTTC 0: 1
1: 0
2: 1
3: 20
4: 319
Right 997704653 5:135936759-135936781 GTAACTTCCTTTACTAGATCGGG 0: 1
1: 0
2: 0
3: 15
4: 221
997704650_997704653 6 Left 997704650 5:135936730-135936752 CCTCACCATGTAGTATTACAAAT 0: 1
1: 1
2: 1
3: 10
4: 163
Right 997704653 5:135936759-135936781 GTAACTTCCTTTACTAGATCGGG 0: 1
1: 0
2: 0
3: 15
4: 221

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997704653 Original CRISPR GTAACTTCCTTTACTAGATC GGG Intronic
905699762 1:40002638-40002660 GTAATTTCATCTACTAGGTCAGG - Intergenic
905777657 1:40679625-40679647 GTAACTTCCTTGGGTAGAGCAGG + Intergenic
908566050 1:65357338-65357360 CTAACTCACTTTACTAGACCTGG + Intronic
909444474 1:75733150-75733172 GTAACTTCCGTTTCTAGAGTTGG + Intronic
910577330 1:88779441-88779463 GTATATTCCTTTAATAAATCTGG - Intronic
912976766 1:114337948-114337970 GTAAATTTCTTTACTAGTTGGGG - Intergenic
914908584 1:151766786-151766808 GTAACTACCTCTACCCGATCTGG + Intronic
914974704 1:152350805-152350827 ATGACTTGCTCTACTAGATCTGG + Exonic
917073848 1:171182703-171182725 GTTAATTCATTTACTAGTTCAGG - Intergenic
917681028 1:177367672-177367694 GTAGCTTCCTTCACTAGATTGGG + Intergenic
917719570 1:177774214-177774236 ATAACTTTATTTACTAAATCGGG - Intergenic
919416294 1:197314587-197314609 TTAACTTCCTTTAAAAGATTTGG + Intronic
922453067 1:225752051-225752073 ATATCTTCCTTTATTAGCTCAGG - Intergenic
923002009 1:230014286-230014308 GGAACTTCCATTAATAGATAAGG + Intergenic
923454613 1:234153062-234153084 GACACTTCCTTTACTTGAGCAGG - Intronic
923540799 1:234886617-234886639 GCAACCTCCTTTAAAAGATCTGG - Intergenic
924134089 1:240945012-240945034 GTCACTTCCTTTCTTAGAGCTGG + Intronic
924603037 1:245508006-245508028 CTAACTTCCTGAACGAGATCTGG - Intronic
1066754511 10:38697257-38697279 GCAAATTCCTTGACTATATCAGG - Intergenic
1071289983 10:84181728-84181750 GAAACTTCCTTTAAAAGAACTGG - Intronic
1072285006 10:93905780-93905802 GTTACTTCCTTTGCTTCATCAGG - Intronic
1082323633 11:51109419-51109441 GTAATTTCCTTTACTACAGTAGG - Intergenic
1082323693 11:51110269-51110291 GTTATTTCCTTTACTAGAGTAGG - Intergenic
1082330086 11:51202642-51202664 GTAATTTCCTTTACTACAGTAGG - Intergenic
1082330560 11:51209443-51209465 GTAATTTCCTTTACTACAGTAGG - Intergenic
1082331774 11:51227293-51227315 GTAATTTCCTTTACTACAGTAGG - Intergenic
1082331893 11:51228993-51229015 GTTATTTCCTTTACTACAGCAGG - Intergenic
1082335158 11:51276259-51276281 GTTATTTCCTTTACTACAGCAGG - Intergenic
1082335748 11:51284758-51284780 GTAATTTCCTTTACTACAGTAGG - Intergenic
1082342179 11:51378270-51378292 GTAATTTCCTTTACTACAGTAGG - Intergenic
1082343218 11:51393571-51393593 GTAATTTCCTTTACTACAGTAGG - Intergenic
1082344685 11:51414820-51414842 GTAATTTCCTTTACTACAGTAGG - Intergenic
1082345794 11:51430975-51430997 GTAATTTCCTTTACTACAGTAGG - Intergenic
1082353471 11:51542171-51542193 GTAATTTCCTTTACTACAGTAGG - Intergenic
1082355163 11:51566827-51566849 GTAATTTCCTTTACTACAGTAGG - Intergenic
1082356145 11:51581276-51581298 GTTATTTCCTTTACTAGAGTAGG - Intergenic
1082357539 11:51601672-51601694 GTAATTTCCTTTACTACAGTAGG - Intergenic
1082359808 11:51635015-51635037 GTAATTTCCTTTACTACAGTAGG - Intergenic
1082361679 11:51662047-51662069 GTAATTTCCTTTACTACAGTAGG - Intergenic
1082364410 11:51701996-51702018 GTAATTTCCTTTACTACAGTAGG - Intergenic
1082364989 11:51710497-51710519 GTAATTTCCTTTACTACAGTAGG - Intergenic
1082365466 11:51717302-51717324 GTAATTTCCTTTACTACAGTAGG - Intergenic
1082367698 11:51749599-51749621 GTAATTTCCTTTACTACAGTAGG - Intergenic
1082370737 11:51793807-51793829 GTAATTTCCTTTACTACAGTAGG - Intergenic
1082370856 11:51795507-51795529 GTTATTTCCTTTACTAGAGTAGG - Intergenic
1082374841 11:51853317-51853339 GTAATTTCCTTTACTACAGAAGG - Intergenic
1082376071 11:51871166-51871188 GTAATTTCCTTTACTACAGTAGG - Intergenic
1082378541 11:51906868-51906890 GTAATTTCCTTTACTACAGTAGG - Intergenic
1082379237 11:51917069-51917091 GTAATTTCCTTTACTACAGTAGG - Intergenic
1082382285 11:51961404-51961426 GTAATTTCCTTTACTACAGTAGG - Intergenic
1082387133 11:52031958-52031980 GTAATTTCCTTTACTACAGTAGG - Intergenic
1082388463 11:52051511-52051533 GTAATTTCCTTTACTACAGTAGG - Intergenic
1082391595 11:52097417-52097439 GTAATTTCCTTTACTACAGTAGG - Intergenic
1082391719 11:52099118-52099140 GTAATTTCCTTTACTACAGTAGG - Intergenic
1082397052 11:52176620-52176642 GTAATTTCCTTTACTACAGTAGG - Intergenic
1082407099 11:52321780-52321802 GTAATTTCCTTTACTACAGAAGG - Intergenic
1082407737 11:52331129-52331151 GTAATTTCCTTTACTACAGTAGG - Intergenic
1082409043 11:52349838-52349860 GTTATTTCCTTTACTAGAGTAGG - Intergenic
1082409920 11:52362587-52362609 GTAATTTCCTTTACTACAGTAGG - Intergenic
1082415239 11:52439294-52439316 GTAATTTCCTTTACTACATTAGG - Intergenic
1082415415 11:52441843-52441865 GTAATTTCCTTTACTACAGTAGG - Intergenic
1082415656 11:52445245-52445267 GTAATTTCCTTTACTACAGTAGG - Intergenic
1082418483 11:52486041-52486063 GTTATTTCCTTTACTAGAGTAGG - Intergenic
1082430863 11:52665393-52665415 GTAATTTCCTTTACTACAGTAGG - Intergenic
1082431629 11:52676443-52676465 GTAATTTCCTTTACTACAGTAGG - Intergenic
1082436929 11:52752945-52752967 GTAATTTCCTTTACTACAGAAGG - Intergenic
1082446239 11:52887230-52887252 GTTATTTCCTTTACTACAGCAGG - Intergenic
1082447111 11:52899981-52900003 GTAATTTCCTTTACTACAGTAGG - Intergenic
1082452104 11:52972247-52972269 GTAATTTCCTTTACTACAGTAGG - Intergenic
1082458395 11:53064055-53064077 GTAATTTCCTTTACTACAGTAGG - Intergenic
1082460099 11:53088705-53088727 GTTATTTCCTTTACTACATTAGG - Intergenic
1082464406 11:53150758-53150780 GTAATTTCCTTTACTACAGTAGG - Intergenic
1082466015 11:53173712-53173734 GTAATTTCCTTTACTACAGTAGG - Intergenic
1082472408 11:53266588-53266610 GTAATTTCCTTTACTACAGTAGG - Intergenic
1082473345 11:53280189-53280211 GTTATTTCCTTTACTACATTAGG - Intergenic
1082476577 11:53326953-53326975 GTAATTTCCTTTACTACAGTAGG - Intergenic
1082477811 11:53344798-53344820 GTAATTTCCTTTACTACAGTAGG - Intergenic
1082486562 11:53470618-53470640 GTTATTTCCTTTACTAGAGTAGG - Intergenic
1082487505 11:53484216-53484238 GTAATTTCCTTTACTACAGTAGG - Intergenic
1082490200 11:53523161-53523183 GTTATTTCCTTTACTAGAGTAGG - Intergenic
1082491726 11:53544176-53544198 GTAATTTCCTTTACTACAGTAGG - Intergenic
1082493889 11:53575625-53575647 GTAATTTCCTTTACTACAGTAGG - Intergenic
1082495817 11:53603690-53603712 GTAATTTCCTTTACTACAGTAGG - Intergenic
1082496416 11:53612193-53612215 GTAATTTCCTTTACTACAGTAGG - Intergenic
1082500865 11:53676454-53676476 GTAATTTCCTTTACTACAGTAGG - Intergenic
1082503606 11:53716413-53716435 GTTATTTCCTTTACTAGAGTAGG - Intergenic
1082511818 11:53835446-53835468 GTAATTTCCTTTACTACAGTAGG - Intergenic
1082516897 11:53908567-53908589 GTAATTTCCTTTACTACAGTAGG - Intergenic
1082517720 11:53920474-53920496 GTAATTTCCTTTACTACAGTAGG - Intergenic
1082518536 11:53932381-53932403 GTTACTTCCTTTACTACAGTAGG - Intergenic
1082521545 11:53975755-53975777 GTAATTTCCTTTACTACAGTAGG - Intergenic
1082522718 11:53993082-53993104 GTAATTTCCTTTACTACAGTAGG - Intergenic
1082527827 11:54066871-54066893 GTAATTTCCTTTACTAAAGTAGG - Intergenic
1082527886 11:54067721-54067743 GTAATTTCCTTTACTACAGTAGG - Intergenic
1082530487 11:54105138-54105160 GTAATTTCCTTTACTACAGAAGG - Intergenic
1082531080 11:54113645-54113667 GTAATTTCCTTTACTACAGTAGG - Intergenic
1082531250 11:54116199-54116221 GTAATTTCCTTTACTACAGTAGG - Intergenic
1082532832 11:54139149-54139171 GTTATTTCCTTTACTAGAGTAGG - Intergenic
1082533181 11:54144252-54144274 GTAATTTCCTTTACTACAGTAGG - Intergenic
1082535569 11:54179108-54179130 GTAATTTCCTTTACTACAGTAGG - Intergenic
1082539116 11:54230125-54230147 GTTATTTCCTTTACTACAGCAGG - Intergenic
1082542998 11:54286412-54286434 GTAATTTCCTTTACTACAGTAGG - Intergenic
1082544570 11:54309370-54309392 GTTATTTCCTTTACTAGAGTAGG - Intergenic
1082548886 11:54369160-54369182 GAAACTTCCTTTGATAGTTCAGG + Intergenic
1082554466 11:54544947-54544969 GAAACTTCCTTTGATAGTTCAGG + Intergenic
1082554531 11:54546280-54546302 GGAACTTCCTTTAATAGTTCAGG + Intergenic
1082554641 11:54548323-54548345 GAACCTTCCTTTGTTAGATCAGG + Intergenic
1082554703 11:54549515-54549537 GAAACTTCCTTTGATAGTTCAGG + Intergenic
1088511829 11:110583555-110583577 GTAAATTCGTTTTCTAGTTCTGG + Exonic
1092245648 12:6862881-6862903 GTACCTTCATTTTCTAGATAAGG + Intronic
1094670599 12:32564563-32564585 GTAAGTCCCTGTACTAGATCAGG - Intronic
1095590689 12:43900290-43900312 GTAACTTCCTAAACTACCTCTGG - Intronic
1096047817 12:48579834-48579856 GGAATTTCCTTGACTAGATGTGG - Intergenic
1097558633 12:61172478-61172500 CTAGTTTCCTTTAGTAGATCAGG - Intergenic
1106635329 13:31522869-31522891 GTAGCTTCCTTCCCTAGCTCTGG + Intergenic
1106900449 13:34350054-34350076 GGAACTGCCTTTACCAGCTCTGG - Intergenic
1114270965 14:21099759-21099781 TTAACTTCCTTTTATAGATAAGG + Intronic
1115036373 14:28861734-28861756 GTAACTTCCTCAACTTGATAAGG - Intergenic
1117051535 14:51865256-51865278 GTGCCTGTCTTTACTAGATCTGG + Intronic
1118508397 14:66442615-66442637 GTAACTTCCTATACTAACTCTGG - Intergenic
1125498430 15:40220063-40220085 GAAACTTCCCTTATTAGATAAGG - Intronic
1126161905 15:45621382-45621404 GTAAGTTCATTTACAAGATGGGG + Intronic
1131845475 15:96486559-96486581 GTTATTTCATTTAGTAGATCGGG + Intergenic
1136728174 16:32379590-32379612 GCAAATTCCTTGACTATATCAGG + Intergenic
1138682842 16:58698709-58698731 GTAACTTCCTTTTTTAGATTTGG + Intergenic
1202998265 16_KI270728v1_random:138164-138186 GCAAATTCCTTGACTATATCAGG - Intergenic
1143065118 17:4241178-4241200 GTAACTTCATTTGATAGATCAGG + Intronic
1145427376 17:22917925-22917947 GAAACTTCCTTTGATAGTTCAGG + Intergenic
1145488712 17:23795324-23795346 GAAACTTCCTTTGATAGGTCAGG + Intergenic
1145493766 17:23868951-23868973 GAACCTTCCTTTGCTAGTTCAGG + Intergenic
1145511070 17:24121037-24121059 GGAACTTCCTTTGATAGTTCAGG + Intergenic
1145523599 17:24302938-24302960 GAAACTTCCTTTGATAGGTCAGG + Intergenic
1145550614 17:24696463-24696485 GAACCTTCCTTTGCTAGTTCAGG + Intergenic
1145560356 17:24837937-24837959 GAAACTTCCTTTGATAGGTCAGG + Intergenic
1145568480 17:24955983-24956005 GAAACTTCCTTTGATAGGTCAGG + Intergenic
1145603916 17:25472072-25472094 GAACCTTCCTTTGCTAGTTCAGG + Intergenic
1145679279 17:26567292-26567314 GAAACTTCCTTTGATAGGTCAGG + Intergenic
1145679790 17:26574658-26574680 GAAACTTCCTTTGATAGGTCAGG + Intergenic
1145679952 17:26577041-26577063 GAAACTTCCTTTGATAGGTCAGG + Intergenic
1145680119 17:26579423-26579445 GAAACTTCCTTTGATAGGTCAGG + Intergenic
1145680281 17:26581803-26581825 GAAACTTCCTTTGATAGGTCAGG + Intergenic
1145680617 17:26586564-26586586 GAAACTTCCTTTGATAGGTCAGG + Intergenic
1145680853 17:26589964-26589986 GAAACTTCCTTTGATAGGTCAGG + Intergenic
1145681205 17:26594948-26594970 GAAACTTCCTTTGATAGGTCAGG + Intergenic
1145681374 17:26597328-26597350 GAAACTTCCTTTGATAGGTCAGG + Intergenic
1145681539 17:26599711-26599733 GAAACTTCCTTTGATAGGTCAGG + Intergenic
1145681868 17:26604473-26604495 GAAACTTCCTTTGATAGGTCAGG + Intergenic
1145682533 17:26614001-26614023 GAAACTTCCTTTGATAGGTCAGG + Intergenic
1145682739 17:26617006-26617028 GAAACTTCCTTTGATAGGTCAGG + Intergenic
1148644851 17:49213863-49213885 GGACCTTCCTTTACTAAATGAGG - Intronic
1151004248 17:70415395-70415417 GTAGCTTCTTTTACTACCTCAGG - Intergenic
1153571230 18:6475450-6475472 GTAATTTTATTTGCTAGATCTGG - Intergenic
1156344449 18:36243140-36243162 CTAACTTCATTTATCAGATCTGG + Intronic
1156596067 18:38549606-38549628 GTAACTTCCTTTAATTAATAAGG - Intergenic
1158248567 18:55460450-55460472 GTAACTTGCTTTAATAAAGCAGG + Intronic
925928821 2:8691056-8691078 CTTACTTCCTGTCCTAGATCGGG - Intergenic
928616098 2:33041007-33041029 ATACCTTCCTTTTATAGATCTGG + Intronic
935257414 2:101323393-101323415 GTAACTCACTTTATTAAATCAGG - Intergenic
936604948 2:113942207-113942229 TTAAATTCTTTTACTAAATCTGG - Exonic
937119980 2:119434325-119434347 TTAACTTCATTTTCTAGATGAGG + Intronic
939008279 2:136815262-136815284 GTCAATTCTTTTTCTAGATCAGG - Intronic
940373793 2:152932487-152932509 GTAATTTTCTTTTCTTGATCTGG - Intergenic
940700401 2:157033913-157033935 GTAACTTTTTTTAGTAGAGCTGG + Intergenic
941094642 2:161223661-161223683 GTAACTTCAATTACTATTTCCGG - Intronic
941391300 2:164918475-164918497 AGAACTTCCTTTACTGGATAAGG + Intronic
943626933 2:190211614-190211636 GAAACCTCCTTAAGTAGATCAGG - Intronic
944148685 2:196534155-196534177 TTAGCATCCTTTACAAGATCAGG + Intronic
944883074 2:204034828-204034850 ATAATTTCCTTTAATAGAGCAGG + Intergenic
945188449 2:207163540-207163562 GAAACCTGCTTTTCTAGATCTGG - Intronic
946007611 2:216538981-216539003 GTGTCTTCCTTGACAAGATCAGG - Intronic
947034180 2:225832754-225832776 GTACCTACTTTTACTAGGTCTGG + Intergenic
948236010 2:236391249-236391271 GTGACTACTTTTGCTAGATCAGG - Intronic
1171353259 20:24521927-24521949 GTAACTTTCATTACTATTTCGGG - Intronic
1171438289 20:25140892-25140914 GTAATTTCCTCTTCTTGATCTGG - Intergenic
1172602423 20:36193094-36193116 GTAGCTTCCATTACTATGTCAGG + Intronic
1180305975 22:11125168-11125190 GCAAATTCCTTGACTATATCAGG - Intergenic
1180544494 22:16487351-16487373 GCAAATTCCTTGACTATATCAGG - Intergenic
1181344615 22:22209608-22209630 GTCACTTCCTTTCCTATACCTGG - Intergenic
1182728249 22:32466055-32466077 GTAACTTCCTTGATTGGTTCTGG + Intergenic
951077410 3:18412391-18412413 GTAAATTCCTTTTATAGAGCAGG - Intronic
951728151 3:25783044-25783066 GAAACTTCCTTTTCTCGAGCGGG + Intronic
959018593 3:101163829-101163851 TTAAATTCTTTTACTAAATCTGG - Intergenic
961043088 3:123691126-123691148 ATAACCTCCTTCACTAGCTCGGG + Intronic
961349228 3:126288418-126288440 ATAACTGCCTTGACTTGATCTGG - Intergenic
965413083 3:168356388-168356410 GTTACTTCATTGACTAGATCAGG + Intergenic
966499215 3:180619611-180619633 GTTACTTCCATTATTAGTTCAGG - Intronic
970940382 4:21625970-21625992 GTAGTTTTGTTTACTAGATCTGG - Intronic
972172916 4:36368642-36368664 GTAACTGCCTATTCTAGATTGGG - Intergenic
973444849 4:50378984-50379006 GAAACTTCCTTTCATAGAGCAGG + Intergenic
973450234 4:50468583-50468605 GAAACTTCCTTTCATAGAGCAGG + Intergenic
973500215 4:51293442-51293464 GAAACTTCCTTTCATAGAGCAGG + Intergenic
979693968 4:123590792-123590814 GAAACTTTATTTACTAGAACAGG + Intergenic
987459366 5:18189866-18189888 GTAACTACCTTTACTATAAATGG - Intergenic
989261036 5:39420775-39420797 GTAACTTCCATTTTTAGACCAGG + Intronic
990320401 5:54624447-54624469 GTATCTTCATTTACTATACCTGG - Intergenic
991133869 5:63157706-63157728 TTGACTTACTTTCCTAGATCTGG - Intergenic
992876660 5:81062758-81062780 CTACCTTCCTTTACTTCATCTGG + Intronic
997704653 5:135936759-135936781 GTAACTTCCTTTACTAGATCGGG + Intronic
1005420504 6:25643493-25643515 AAAACTTCCATCACTAGATCTGG - Intergenic
1005563566 6:27066481-27066503 GAAACGTCCTTTCCTAGATGTGG - Intergenic
1009745554 6:67809898-67809920 AGAACTTCCTTTACTACATCAGG - Intergenic
1015973420 6:138765355-138765377 GTAATTTCCTTAGCTAAATCTGG - Intronic
1017423110 6:154293800-154293822 GCAACTTCCTTTACTGTATTTGG - Intronic
1021880431 7:25090142-25090164 CAAACTTCATTTGCTAGATCAGG + Intergenic
1027709310 7:81578418-81578440 TCAACTTCCTGTCCTAGATCTGG + Intergenic
1030620152 7:111780670-111780692 GTGACATCCTTTACAAGATCGGG - Intronic
1032594992 7:133230690-133230712 GTATTTTTATTTACTAGATCTGG + Intergenic
1034331421 7:150286497-150286519 GCAAATTCCTTGACTATATCGGG + Exonic
1034666622 7:152823363-152823385 GCAAATTCCTTGACTATATCGGG - Exonic
1039462840 8:37760589-37760611 GTAGCTTCATTTACTAGATTGGG - Intergenic
1042608266 8:70568969-70568991 GTTACATCCTTTACTAGTTTTGG - Intergenic
1046808272 8:118504243-118504265 GTGACTTCCTCTCCTAGACCAGG + Intronic
1049410417 8:142471511-142471533 GTTGCTTCCTTTTCTTGATCAGG - Intronic
1055190025 9:73507713-73507735 GTTAATTCCTTTGCTGGATCTGG + Intergenic
1056425401 9:86470612-86470634 GTAATTTCCAGTACTAGTTCAGG + Intergenic
1057123337 9:92596856-92596878 GAAGTTTCCTTTACTAGATCAGG + Intronic
1058339787 9:103880160-103880182 GTATCTTCATTTACTAGAACAGG + Intergenic
1058340130 9:103885439-103885461 TTTACTTCATTTACAAGATCAGG + Intergenic
1203341610 Un_KI270424v1:1250-1272 GGAACTTCCTTTAATAGTTCAGG + Intergenic
1186653198 X:11584278-11584300 GTAACTTTCTTATATAGATCTGG - Intronic
1186881457 X:13870848-13870870 CTAACTTCTTTAAATAGATCTGG - Intronic
1188337384 X:28953794-28953816 GTAACTGCCTTTAAATGATCTGG - Intronic
1191368954 X:59840382-59840404 GAAACTTCCTTTGATAGTTCAGG + Intergenic
1191416607 X:60478185-60478207 GAAACTTCCTTTGATAGTTCAGG + Intergenic
1191518016 X:61835615-61835637 GAAACTTCCTTTGATAGTTCAGG + Intergenic
1191520787 X:61872640-61872662 GAAACTTCCTTTGATAGTTCAGG + Intergenic
1191531889 X:62020945-62020967 GAAACTTCCTTTGATAGTTCAGG + Intergenic
1191561477 X:62466902-62466924 GAAACTTCCTTTGATAGTTCAGG - Intergenic
1191563186 X:62489526-62489548 GAAACTTCCTTTGATAGTTCAGG - Intergenic
1191570266 X:62605941-62605963 GAAACTTCCTTTGATAGAGCCGG + Intergenic
1192159423 X:68772025-68772047 TTAAATTCCTTTACTAAATCTGG - Intergenic
1194273692 X:91853495-91853517 AAAACTTCCTTTACTAGCTGAGG - Intronic
1197283053 X:124560628-124560650 GTTTCTTCCTTTACTTGTTCTGG - Intronic
1199077575 X:143541881-143541903 GTAATGTCCTTTACTGGATTTGG - Intergenic
1199368181 X:147013399-147013421 CTGAATTCATTTACTAGATCTGG - Intergenic
1200590933 Y:5074919-5074941 AAAACTTCCTTTACTAGCTGAGG - Intronic
1201185368 Y:11396530-11396552 GCAAATTCCTTGACTATATCAGG - Intergenic