ID: 997704685

View in Genome Browser
Species Human (GRCh38)
Location 5:135937493-135937515
Sequence TTGAAATCAAGCCCAAGGTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 147
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 136}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997704685_997704690 10 Left 997704685 5:135937493-135937515 CCAGACCTTGGGCTTGATTTCAA 0: 1
1: 0
2: 0
3: 10
4: 136
Right 997704690 5:135937526-135937548 AAGTTTCATGAATGTGTCGGAGG 0: 1
1: 0
2: 0
3: 9
4: 94
997704685_997704691 15 Left 997704685 5:135937493-135937515 CCAGACCTTGGGCTTGATTTCAA 0: 1
1: 0
2: 0
3: 10
4: 136
Right 997704691 5:135937531-135937553 TCATGAATGTGTCGGAGGTAAGG No data
997704685_997704688 7 Left 997704685 5:135937493-135937515 CCAGACCTTGGGCTTGATTTCAA 0: 1
1: 0
2: 0
3: 10
4: 136
Right 997704688 5:135937523-135937545 GCCAAGTTTCATGAATGTGTCGG 0: 1
1: 0
2: 2
3: 11
4: 149

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997704685 Original CRISPR TTGAAATCAAGCCCAAGGTC TGG (reversed) Intronic
900766637 1:4510266-4510288 TTGAAATCAATACCAAAGTGTGG - Intergenic
904317740 1:29676771-29676793 ATGAAATTAAGCCCATGGCCAGG + Intergenic
905745821 1:40416545-40416567 GTGAAGTCTAGCTCAAGGTCTGG + Intronic
907688521 1:56638193-56638215 TTGAAGACATGCCCAAGGACAGG - Intronic
913250321 1:116908026-116908048 TTGAATTCAAGCCTAATGTTAGG - Intergenic
917263591 1:173195942-173195964 TTGGCATGAAGCCCAAGGTGCGG - Intronic
918863231 1:189860297-189860319 TAGGACTCAAGCACAAGGTCTGG - Intergenic
919727630 1:200894446-200894468 TGGAAATGAAGACCAAGGCCTGG - Intronic
920736253 1:208535574-208535596 TTGAAAGCTGGCCCAAGATCTGG + Intergenic
922146774 1:222954387-222954409 TTGAAATAGAGCCTAAGGCCTGG + Intronic
1062956559 10:1544180-1544202 TTGAAAGCAACGCCAGGGTCTGG + Intronic
1068746664 10:60539817-60539839 ATGAAATCAAGCCCTATTTCAGG + Intronic
1070962139 10:80506772-80506794 TAGAAAACACGCCCAAGGGCAGG - Intronic
1072253181 10:93597872-93597894 TTTAAAGCAAGACCATGGTCAGG + Intronic
1073097657 10:100989576-100989598 TTGAAACCAAGACATAGGTCAGG - Intronic
1074485862 10:113878822-113878844 TAGAAAACAAACCCAAGGCCTGG - Intronic
1076550649 10:131275858-131275880 TGGAGATCCAGCACAAGGTCTGG + Intronic
1079119342 11:17670632-17670654 TTGAACTCACCCCCAACGTCAGG + Intergenic
1079920918 11:26433458-26433480 TTGAAAACAAGCACAAGGCAAGG - Intronic
1080282178 11:30569905-30569927 CTAAAGTCAAGCCCAAGGTCAGG + Intronic
1080807159 11:35663649-35663671 CTCAAATCAAGCCCATGGTCCGG - Exonic
1081073163 11:38635106-38635128 TTGAAAAGAAGCCAAAAGTCTGG + Intergenic
1081585303 11:44380054-44380076 TTGAAACCAAGCACCAGGTAGGG - Intergenic
1081973615 11:47216810-47216832 TTGAATTAAAACCCAAGTTCTGG - Intronic
1083110443 11:60401007-60401029 TTTAGATCCTGCCCAAGGTCTGG + Intronic
1084564554 11:69921631-69921653 ATAAAATCCAGCCCGAGGTCTGG - Intergenic
1084901975 11:72316402-72316424 CTGAAATCAAGCCCAAGGAGTGG + Intronic
1087774058 11:102241704-102241726 TTAAAATCAAGAGCAAGGCCGGG + Intergenic
1099695006 12:86007264-86007286 TTGAAATAAAGCCCCATTTCAGG - Intronic
1099852137 12:88113575-88113597 TTGAAATCAAGCACAAATTTGGG + Intronic
1099962515 12:89410382-89410404 TTGAAAACCGGCACAAGGTCGGG + Intergenic
1104879316 12:132059183-132059205 TTGAATTCAAGTCCAAGGCTGGG + Intronic
1108418231 13:50222459-50222481 TTAAAACCAAGACCCAGGTCTGG + Intronic
1109658553 13:65427938-65427960 CTGAGGTGAAGCCCAAGGTCTGG + Intergenic
1113244075 13:108375776-108375798 TTTAAATCAAGCACAAATTCTGG - Intergenic
1114406014 14:22456983-22457005 CTGAAAAAAAGCCCTAGGTCAGG + Intergenic
1119763366 14:77170860-77170882 TTAAAAGTAAGCCCAATGTCTGG + Intronic
1122701236 14:103590504-103590526 GTGAAATAAAGCCCAAGCACTGG + Exonic
1126866526 15:52943028-52943050 GTGAAACCAAGCACAAAGTCCGG + Intergenic
1131204665 15:90432985-90433007 TTGATATCAAGCCCAGAGCCAGG - Intronic
1131486212 15:92822939-92822961 TTGAAATTAAGCCTAATTTCTGG + Intergenic
1134109241 16:11504258-11504280 TAGAAATCAAGTCCAGGGCCTGG + Intronic
1135251399 16:20903214-20903236 TTCAAATGAAGCCCAAAGTCTGG - Intronic
1136859408 16:33688372-33688394 TTAAGAACAAGCCCAAGGCCAGG - Intergenic
1139608870 16:68040376-68040398 TTGAAAACAATCCTAAGGCCGGG - Intronic
1139674019 16:68510475-68510497 TTGAAATGAAACACAAGGGCCGG + Intergenic
1203120915 16_KI270728v1_random:1536561-1536583 TTAAGAACAAGCCCAAGGCCAGG - Intergenic
1142850870 17:2704180-2704202 TGGGAATCGAGCCCAGGGTCAGG - Intronic
1143744366 17:8980377-8980399 TAGAAATGAAGCCAAAAGTCTGG + Intergenic
1153091573 18:1351915-1351937 TGGAAGTAAAGCCCAAAGTCTGG - Intergenic
1153095865 18:1402137-1402159 CTGAAATGAAGCAAAAGGTCTGG + Intergenic
1155410875 18:25543248-25543270 TTGAAGTAAAGCTCAAGATCTGG - Intergenic
1155890533 18:31262796-31262818 TTGAAATCTTGCCCAATATCAGG - Intergenic
1161314747 19:3612601-3612623 TAGACATGAAGACCAAGGTCCGG - Intronic
1162087337 19:8256694-8256716 TTGATGTCAAGCGCAAGGTGAGG + Exonic
1162108087 19:8383016-8383038 ATGAAATCAAGCCTGAAGTCTGG + Intronic
1167231375 19:48286207-48286229 CTGAAATCAAGCACATGGACTGG + Exonic
932225045 2:70033021-70033043 TTTAAAACATGCCCAAGGACAGG - Intergenic
932560442 2:72863010-72863032 CTGAAAACAAGCGCAAGGTAGGG - Intergenic
933412040 2:81938736-81938758 ATGAAATCAAGCACAAAGTATGG + Intergenic
933749100 2:85591701-85591723 TGGACACCAAGCCCGAGGTCAGG - Intronic
936613033 2:114020200-114020222 TTAAAATAAAACCCAAGGCCAGG + Intergenic
939550944 2:143614813-143614835 TTGAAATGAAACCCAATGTAGGG + Intronic
941748865 2:169114827-169114849 GGGCAATCAAGGCCAAGGTCAGG - Intergenic
942612913 2:177760661-177760683 TTGAAATTAACCAAAAGGTCTGG + Intronic
942756648 2:179349066-179349088 TTGAAGTCATGCACAAGGCCAGG - Intergenic
943990589 2:194685970-194685992 TTAAAATCAGGAGCAAGGTCTGG + Intergenic
944126769 2:196302978-196303000 TTGAAATCCAGCACAAGGCAAGG - Intronic
945931177 2:215855960-215855982 TTGAAAATAGGCCCAAGGACAGG + Intergenic
946537601 2:220648308-220648330 TGGAAATGAAGGCCAAGGTCAGG - Intergenic
947501536 2:230674760-230674782 TTGGAACCAAGCACAAGCTCCGG + Intergenic
948361218 2:237421925-237421947 TTGAAATTAATCCCAGGGTGAGG - Intronic
948400763 2:237683237-237683259 CTAAAATCAAGCCGACGGTCAGG + Intronic
948611974 2:239175837-239175859 TTTAAATCAAACCAAAAGTCGGG + Intronic
1169686913 20:8285676-8285698 TTGAAATGAAGCTCCAGGTCAGG + Intronic
1170171637 20:13419936-13419958 TTGACATCCAGAGCAAGGTCTGG + Intronic
1173551923 20:43938368-43938390 TTGAATGGAAACCCAAGGTCAGG - Intronic
1175387584 20:58607085-58607107 TTGAAATAAAGCCCAAAGCTTGG - Intergenic
1175483707 20:59329640-59329662 CTGAACTCAAGCCAGAGGTCAGG + Intergenic
1177945670 21:27466864-27466886 TTGAAATCTAGACCTAGGTAAGG - Intergenic
1178868370 21:36349957-36349979 TCCAAATCCAGCCCAAGTTCTGG - Intronic
1182073213 22:27477601-27477623 TTGAATTCAACCCCAGGGGCTGG - Intergenic
949431824 3:3985146-3985168 TTGAAATGAAGCCCTGGTTCAGG + Intronic
962849831 3:139299977-139299999 TTGAAAGCAAGCACATGCTCTGG + Intronic
964453903 3:156839467-156839489 TTGAAGTCATGCACAACGTCTGG - Intronic
966055712 3:175686808-175686830 TTTGAAGGAAGCCCAAGGTCAGG + Intronic
966532921 3:181000566-181000588 TTGAAAACAAGCACAAGGCAAGG - Intergenic
967123717 3:186406379-186406401 TTGAAATCCAGGCCAAGAACCGG - Intergenic
967261485 3:187647223-187647245 TTGAAGTGAAGAACAAGGTCTGG - Intergenic
970779073 4:19713740-19713762 TTAAAAACATGCCCAAGGCCGGG + Intergenic
972379999 4:38510663-38510685 TTGAAAGGAAGACCAAGGTAAGG + Intergenic
974319091 4:60321562-60321584 TTAAAATCAAGCACAAGTCCAGG + Intergenic
975053476 4:69896783-69896805 TTAAAATAAATCCCAAAGTCTGG - Intergenic
975421100 4:74165650-74165672 TTAAAATTAAGCACAAGGGCCGG - Intronic
977042664 4:92034094-92034116 TTTACATCAAGCCCAATCTCTGG + Intergenic
977522448 4:98101876-98101898 TTGGAATCAAGGCTAAGGTCGGG - Intronic
982972569 4:162008791-162008813 TGTAAATCAAGCCCAAGTTTAGG - Intronic
983100948 4:163624780-163624802 TTGAAAGAAAGGCCAAGTTCTGG - Intronic
984092422 4:175390607-175390629 TTGAAATCCAGCACAAGATAAGG + Intergenic
986353233 5:6899894-6899916 TTGCAATCAAGCCCAATTACAGG + Intergenic
986549227 5:8934404-8934426 TTGAAATTATGACCCAGGTCTGG - Intergenic
987046634 5:14115164-14115186 TTAAAAGAGAGCCCAAGGTCTGG - Intergenic
988565650 5:32318406-32318428 TAGAAATCTAGTCCAAGGTTTGG - Intergenic
997408045 5:133668090-133668112 TTGAAATCATCCCTAAAGTCTGG - Intergenic
997704685 5:135937493-135937515 TTGAAATCAAGCCCAAGGTCTGG - Intronic
998976148 5:147650521-147650543 ATGAAATCAAAGCCAAGGACAGG - Exonic
999354051 5:150906975-150906997 TTGCAATCAAGCCATAGGCCAGG + Intergenic
1002343125 5:178529764-178529786 TTTAAATCAGGCCTGAGGTCTGG - Intronic
1004349148 6:14875878-14875900 TTGAAAACAAACCCTAAGTCTGG - Intergenic
1018037275 6:159892333-159892355 TAGAAATCCAGCCTAGGGTCAGG + Intergenic
1018125055 6:160674408-160674430 TTGAAAACCAGCACAAGGTAAGG + Intergenic
1019036266 6:169062472-169062494 AGGAAAGCAAGCCCAAGGGCTGG + Intergenic
1019232738 6:170582266-170582288 CTGTTATCAAGCACAAGGTCAGG + Intronic
1019460805 7:1157881-1157903 GTGAAAACAATCCCAGGGTCAGG + Intronic
1023674944 7:42619191-42619213 TTAAAATCAAGACTAAGGTTTGG - Intergenic
1025173458 7:56782483-56782505 TGAAAATCAAGTCCACGGTCGGG - Intergenic
1025698644 7:63795688-63795710 TGAAAATCAAGTCCACGGTCGGG + Intergenic
1028090304 7:86692183-86692205 TTGGAAACAAGCCCAAAGTATGG - Intronic
1031736664 7:125371938-125371960 TTGAAAACAAGGCAAATGTCAGG - Intergenic
1035258304 7:157646190-157646212 TTGAAATGTAGCCCCAGGGCTGG + Intronic
1038712081 8:29956763-29956785 TAGAATTCAAGACAAAGGTCTGG + Intergenic
1042507485 8:69576338-69576360 TTGACATCTACCCCAGGGTCTGG + Intronic
1043078004 8:75727044-75727066 TTGAAATGAAGGCAAAGTTCTGG + Intergenic
1044155553 8:88841573-88841595 TTTAAATCAAGCCCAAGTGCAGG - Intergenic
1046222274 8:111231769-111231791 TTTACATCAAGCCCAATCTCTGG - Intergenic
1047725943 8:127684045-127684067 TTGACTTAAGGCCCAAGGTCAGG - Intergenic
1048145036 8:131833475-131833497 TGGAGATCAAGCCTCAGGTCAGG - Intergenic
1049672752 8:143877178-143877200 TTCATACCAGGCCCAAGGTCAGG - Intronic
1053598651 9:39588256-39588278 TAGAAATAAAACCCAAGCTCTGG - Intergenic
1057731165 9:97609714-97609736 TTGAAAGCAACCCCAATGTCAGG - Intronic
1058809801 9:108628483-108628505 TTGGCACCAAGTCCAAGGTCTGG - Intergenic
1061239005 9:129358470-129358492 TAGAAAACCAGCCCAAGGGCCGG - Intergenic
1061964221 9:134004127-134004149 TTGAGAAGAACCCCAAGGTCTGG + Intergenic
1185982594 X:4796189-4796211 TTGGAATCAAGCCCAAGTCTAGG + Intergenic
1191067887 X:56369458-56369480 TTGAAATCTATCACAATGTCTGG + Intergenic
1192672620 X:73161690-73161712 TTGACTTAAAGCCCAAGGTCTGG + Intergenic
1195717520 X:107831237-107831259 CTGAGACAAAGCCCAAGGTCAGG - Intronic
1196142824 X:112283890-112283912 TAGAAATAAAGGCCAAGTTCTGG - Intergenic
1196649417 X:118153656-118153678 TTGAATTCAAGGCAAAGTTCAGG - Intergenic
1197353809 X:125409516-125409538 TTGATATTAAGTCCAATGTCTGG + Intergenic
1197835209 X:130686858-130686880 TTGAATTCAATTCCAAGGCCAGG + Intronic
1197937378 X:131753491-131753513 TTGAAATCAAACTAAAGGCCGGG + Intergenic
1198580742 X:138061556-138061578 TTGCAATCATGGCCAAGCTCAGG + Intergenic
1199019967 X:142867895-142867917 TTGAAAACAAGTGCAAAGTCAGG + Intergenic
1199410910 X:147521660-147521682 TTGAAAACCAGCCCAAGTTAAGG + Intergenic
1199471893 X:148204885-148204907 TTGAAAGCAAGCCACAGGTACGG - Intergenic
1201694929 Y:16814367-16814389 TTGGAATCAACCCCAAGTCCAGG - Intergenic