ID: 997706079

View in Genome Browser
Species Human (GRCh38)
Location 5:135953904-135953926
Sequence AAAATTATGAAACGTGGAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 287
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 268}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997706079 Original CRISPR AAAATTATGAAACGTGGAGG AGG Intronic
901411798 1:9089434-9089456 AAAATTATAAAAATTAGAGGAGG + Intergenic
901691291 1:10974850-10974872 TAAATTATCAAACCTGAAGGTGG + Intronic
901859525 1:12064979-12065001 AACATTAAAAAAAGTGGAGGGGG - Intronic
902032369 1:13432129-13432151 AAAAATTAGCAACGTGGAGGAGG + Intergenic
902051487 1:13567053-13567075 AAAATGATGAAATGTTGGGGTGG - Intergenic
902417254 1:16247549-16247571 AAAATAAAGAAAAGAGGAGGAGG - Exonic
905502801 1:38452954-38452976 AAAATTATCCAGCGTGGTGGCGG - Intergenic
905555135 1:38876660-38876682 AAAAACATGATACCTGGAGGAGG + Intronic
906685628 1:47761404-47761426 GAACTTCTGAAAGGTGGAGGAGG - Exonic
910085191 1:83393506-83393528 AAAACTACAAAAGGTGGAGGAGG + Intergenic
910337737 1:86154490-86154512 AAAATTATAAAACGTGGAATGGG - Intronic
911556279 1:99348703-99348725 AGAATTATCATAAGTGGAGGCGG - Intergenic
911941725 1:104056009-104056031 ATAATGATGAATCCTGGAGGTGG - Intergenic
911966479 1:104378440-104378462 AAAATTAATAAATGTTGAGGTGG + Intergenic
912156334 1:106924974-106924996 AAAATTATGGAAAATGCAGGAGG - Intergenic
917063062 1:171061796-171061818 TATATTCTGAAAGGTGGAGGAGG + Intronic
918019977 1:180677991-180678013 CAAATTATCAAACCTGGAGGTGG - Intronic
919134404 1:193489852-193489874 CAAATTATCAAACTTGGGGGGGG + Intergenic
920929668 1:210375487-210375509 AATATAATGAAATGGGGAGGTGG - Intronic
922228375 1:223665261-223665283 AAAATTAAAAAAGGTGGTGGTGG + Intronic
922964331 1:229675437-229675459 AAAATTATGAAATCTGGCAGAGG - Intergenic
923274860 1:232387022-232387044 AAAAATTTGAAACTTGGAGAGGG + Intergenic
924507561 1:244700207-244700229 AAAATCATCAAACCTCGAGGTGG + Intronic
1064640469 10:17410367-17410389 AAAATTCTGAAACGCAAAGGAGG + Intronic
1066986506 10:42472892-42472914 AAAATTATGCAAACTGGAGGAGG + Intergenic
1067383900 10:45800906-45800928 AAAATTGTGAAACATTGTGGAGG + Intergenic
1067891595 10:50141480-50141502 AAAATTGTGAAACATTGTGGAGG + Intergenic
1069566877 10:69469355-69469377 CAAATTATCAAACTTGGAGAAGG + Intronic
1070984227 10:80674212-80674234 GCAATTGTGAAATGTGGAGGTGG - Intergenic
1072085915 10:92078994-92079016 GAAATAATAAAACCTGGAGGAGG - Intronic
1075001478 10:118801958-118801980 CAAATTAGGAAAAGTGAAGGAGG - Intergenic
1075633184 10:124013591-124013613 AAAATTACTAAACCTGAAGGTGG + Intronic
1075815725 10:125263709-125263731 AAAATGATGCAACGTGGCTGAGG - Intergenic
1075907983 10:126098999-126099021 AAAATTATCAACCCTGGAGCCGG + Intronic
1076527680 10:131122702-131122724 CAAATTATCAAACTTGAAGGAGG + Intronic
1077945543 11:6893690-6893712 AAAATTTTGAAATGTAGTGGTGG + Intergenic
1079431786 11:20396977-20396999 AAAATTCTGAAACAGGGAAGAGG - Intronic
1079599988 11:22299404-22299426 AAAGTAATGAAAAATGGAGGAGG + Intergenic
1079728612 11:23911079-23911101 AAAATTATGAAACCTAAACGTGG + Intergenic
1080053313 11:27879304-27879326 AACATTTTGAAATTTGGAGGAGG - Intergenic
1080551127 11:33375123-33375145 AAAAGAATGAAACGTGGGGAGGG - Intergenic
1080974937 11:37327848-37327870 AAAATGAAGAAATGTGGAGCAGG - Intergenic
1081028022 11:38040113-38040135 AAAATAATGAAAAGTGGAATTGG - Intergenic
1081434980 11:43017419-43017441 AAATTTATGAAACTTGGAGATGG + Intergenic
1082832216 11:57626983-57627005 AAAATTTTGAAATGTGGCCGTGG + Intergenic
1084185818 11:67470405-67470427 AAAAAAATGAACCGTGGTGGGGG + Intergenic
1085901336 11:80703361-80703383 AAAATGAGGTAACATGGAGGTGG + Intergenic
1085985608 11:81784185-81784207 AAAATTATTAAAGATGGTGGAGG + Intergenic
1086391832 11:86373009-86373031 AAAATTTTGTATGGTGGAGGAGG - Intergenic
1088196251 11:107277121-107277143 AAAATTGTGAAATGTGGAGAGGG - Intergenic
1088433445 11:109783785-109783807 AAAATTGTGACAAATGGAGGAGG - Intergenic
1090454477 11:126836188-126836210 AAAATTATGAAACCTGACAGTGG + Intronic
1093098442 12:14998811-14998833 AAAATGAGAAAATGTGGAGGTGG + Intergenic
1093240861 12:16671326-16671348 AAAAGTCTGAAATATGGAGGAGG - Intergenic
1093519879 12:20036337-20036359 AAAAATATGAAATATAGAGGAGG - Intergenic
1093851398 12:24043894-24043916 AAAATTATGATACGTGATGGAGG - Intergenic
1093989294 12:25571991-25572013 AAAGGTAGGAAAGGTGGAGGTGG + Intronic
1095927363 12:47592306-47592328 AAAATTATGAAATGAGGACCTGG + Intergenic
1097242453 12:57584966-57584988 AATATTTTGAAAAATGGAGGAGG + Exonic
1097945116 12:65358973-65358995 AAAATTAGGAAGAGGGGAGGGGG - Intronic
1098163159 12:67666967-67666989 AAAATTATAAAAAGTGAAAGAGG + Intergenic
1098313320 12:69169069-69169091 CAAATTATGGAACCTGAAGGAGG - Intergenic
1098456429 12:70680166-70680188 GAAATTATGAATTGTGGATGGGG - Intronic
1098831420 12:75368304-75368326 AAAATAATGAAAAATGCAGGAGG - Intronic
1099332749 12:81311431-81311453 AACATTAAGAAAGGTAGAGGCGG + Intronic
1099582345 12:84466247-84466269 AAAATTAGCAGACGTGGTGGTGG - Intergenic
1102752981 12:115312129-115312151 AAATTTATGTAGGGTGGAGGTGG - Intergenic
1102909394 12:116701029-116701051 AAAATTATGCCACGTGTAAGGGG + Intergenic
1104692932 12:130839898-130839920 CAAATTATGGAACTTGAAGGTGG - Intergenic
1105654637 13:22423026-22423048 AAAATTAGGAAAAGTGGGGAGGG - Intergenic
1107607546 13:42075655-42075677 AAACTTAAGAAAGGTGCAGGTGG + Intronic
1107813827 13:44226116-44226138 GAAATTATGGAAAGTGGAAGAGG - Intergenic
1108149484 13:47517914-47517936 AAAATTATGAAACATGATTGGGG + Intergenic
1108751001 13:53448271-53448293 ACATTTATCAAACGTGGATGGGG + Intergenic
1109011103 13:56945558-56945580 AAAATTATGAAATGTCAAGCAGG - Intergenic
1109301121 13:60591218-60591240 AAAATTTTGAGAAGCGGAGGTGG - Intergenic
1109375807 13:61491181-61491203 AAAATTAAGAATAGTGGAAGGGG - Intergenic
1109499351 13:63215698-63215720 AAAATAAGGTAACGTGGAGTGGG - Intergenic
1111222031 13:85217951-85217973 AAAATTTTGAATCTTGGAGGAGG + Intergenic
1111947357 13:94679834-94679856 TATATTATGAAGGGTGGAGGAGG - Intergenic
1113290091 13:108895998-108896020 GAAATTATGTAACGCTGAGGAGG - Intronic
1113898584 13:113783032-113783054 AAAATTATAAAAATTAGAGGAGG - Intronic
1114274478 14:21130295-21130317 AAAACTATAAAACCTCGAGGTGG + Intergenic
1114411289 14:22502925-22502947 AAAATTCTGAATAGTGTAGGTGG - Intergenic
1114986407 14:28234912-28234934 AAAATTCTGAAACTTGCAGAAGG - Intergenic
1117228162 14:53685394-53685416 AAATTGATGAATCGTAGAGGTGG + Intergenic
1117376460 14:55122610-55122632 AAAATCAGGGAACGTGGAGGAGG - Intergenic
1118419466 14:65585121-65585143 AGAATTATAAAATGGGGAGGGGG - Intronic
1118640969 14:67792109-67792131 ATAATTATGATCCTTGGAGGAGG - Intronic
1119284415 14:73440739-73440761 AATAGTATGAAACCGGGAGGTGG + Intronic
1124209142 15:27747909-27747931 AGAACTCTGAAACGTGGATGAGG + Intergenic
1124932221 15:34131769-34131791 AAAATAAAGAAGGGTGGAGGTGG - Intergenic
1125150241 15:36522571-36522593 AAAATTATAGAACCTGAAGGGGG + Intergenic
1126172972 15:45709322-45709344 AAGAGGATGAAACATGGAGGAGG + Intergenic
1126609612 15:50516004-50516026 AAAATCATAAAATGTTGAGGGGG + Intronic
1127350840 15:58150304-58150326 AATATTCTGAAACTTGTAGGAGG - Intronic
1128518255 15:68357616-68357638 AAAATTATGAATAGTGTGGGTGG + Intronic
1129923635 15:79342039-79342061 AAAACTAAAAAACGTGGATGGGG + Intronic
1133199420 16:4193829-4193851 AAAATTATCCAACGTGTAGTAGG + Intronic
1133527293 16:6617921-6617943 AAACTTTTCAAACATGGAGGTGG + Intronic
1134161299 16:11892001-11892023 AAAATTATGGAAAGTGTAAGTGG + Intronic
1134800515 16:17080197-17080219 AAGATAATGGAAGGTGGAGGAGG - Intergenic
1135527940 16:23228284-23228306 AAAAGTAGGAAAAGTGGAGGGGG - Intergenic
1140893411 16:79304626-79304648 AAGATTATGAAAAATGGTGGTGG + Intergenic
1141272371 16:82553148-82553170 AAAATTATGATAACTAGAGGAGG + Intergenic
1142856519 17:2733553-2733575 AAAATTATGAGAAGAGGAGCTGG - Intergenic
1143403768 17:6662646-6662668 AAACTTCAGAAACTTGGAGGAGG - Intergenic
1145218173 17:21067834-21067856 AAAATTATAAAAAGTGGGGCGGG + Intergenic
1148400034 17:47350453-47350475 AAAATTATGAAGGGGTGAGGAGG - Intronic
1148621469 17:49038009-49038031 AAAGTTGTGAAAAATGGAGGTGG + Intronic
1148973015 17:51500724-51500746 AGAATTATGAAGCCTGGATGTGG - Intergenic
1150094984 17:62366041-62366063 AAAATTAAGAGAGGTGGTGGTGG - Intergenic
1150610092 17:66726872-66726894 AAAATTAGCCAACGTGGTGGTGG - Intronic
1150854284 17:68735613-68735635 AAAAATATGAAACATAGAAGAGG + Intergenic
1151861923 17:76770671-76770693 CAAATTATCAAACATGAAGGGGG - Intronic
1153781497 18:8499033-8499055 AGAAATAGGAAAGGTGGAGGAGG + Intergenic
1157637345 18:49171601-49171623 AAAATTATTAGAGGTGGAGTGGG + Intronic
1158341019 18:56466154-56466176 AAAATTTAGAAACTTGGAGATGG - Intergenic
1158595455 18:58811944-58811966 AAAATTATGAAATCTGCAGTGGG - Intergenic
1158922505 18:62208988-62209010 AAGATCTTGAAAAGTGGAGGAGG - Intronic
1159910139 18:74138236-74138258 AAAATTAGGGAGCTTGGAGGTGG - Intronic
1160172197 18:76564197-76564219 AAAAAAATTAAACCTGGAGGAGG - Intergenic
1160993306 19:1870246-1870268 ACAAATATGAAAAGTGGATGTGG + Intergenic
1161140784 19:2646533-2646555 AAAATTAGCCAACGTGGTGGTGG + Intronic
1164136159 19:22418257-22418279 CAAATTATGAAACTTGAGGGAGG - Intronic
925887847 2:8408771-8408793 AAAATTATCAAACCTGAATGGGG + Intergenic
926325128 2:11778852-11778874 AAATTCAGGAAACATGGAGGTGG + Intronic
928935079 2:36667972-36667994 AAAATAATGAAGCGTAGATGTGG + Intergenic
928940197 2:36719636-36719658 AAAATTATAAAACGTTGATGAGG + Intronic
929521253 2:42653277-42653299 CAGATTATCATACGTGGAGGAGG + Intronic
929724445 2:44410096-44410118 AAAAGTATGAAACTGGTAGGGGG + Intronic
931059507 2:58511033-58511055 AAAATTATGAATAGAGGAGCTGG + Intergenic
931276760 2:60750704-60750726 AAAATTAAAAAAAGAGGAGGAGG + Intergenic
931364647 2:61608672-61608694 AAAATAATGAACCTGGGAGGCGG + Intergenic
932877857 2:75472356-75472378 ATAATTATGAAACATGGAAAAGG + Intronic
933486463 2:82930724-82930746 ATATTGATGAAACATGGAGGTGG - Intergenic
934216172 2:90033684-90033706 AAAATTATAACACTTGGAGTTGG - Intergenic
936779868 2:116019245-116019267 AAAAGTGTGAAACGTAGATGTGG + Intergenic
937451871 2:122008854-122008876 AAACTTGTGAAACGAGGAAGTGG - Intergenic
937738792 2:125323521-125323543 AAAATTATCAAATCTGGAGAAGG + Intergenic
940754590 2:157667494-157667516 AAAGTTAAGAAAAATGGAGGGGG + Intergenic
940894683 2:159069475-159069497 AAAATTAAGAAACGTGGTAAAGG - Intronic
941594317 2:167456632-167456654 AAAATTATCAAACCTGAGGGGGG - Intergenic
942309582 2:174642815-174642837 GGAAATAAGAAACGTGGAGGAGG - Intronic
942358792 2:175149266-175149288 AAAATTGTTAAAGGTGGGGGCGG + Intronic
943479626 2:188402056-188402078 AATATTCTGAAACTTGGAAGGGG - Intronic
943566554 2:189523641-189523663 AGAATTTTGAAAAATGGAGGAGG - Intergenic
1169593773 20:7175395-7175417 CAAATTACCAAACCTGGAGGTGG + Intergenic
1169687819 20:8295967-8295989 AAAATAAGTAAACTTGGAGGAGG - Intronic
1171062578 20:21980777-21980799 GCAATAATGAAACCTGGAGGAGG - Intergenic
1171135870 20:22694009-22694031 AAAAATATGAAACCTGGAATGGG - Intergenic
1172785887 20:37468592-37468614 AAAATAATGAGATGTTGAGGTGG + Intergenic
1174737107 20:52974579-52974601 AACAGAATGAAATGTGGAGGTGG - Intronic
1176994131 21:15534424-15534446 AAAATTTAGAAACTTAGAGGAGG + Intergenic
1177161214 21:17550202-17550224 AAAATTAGCAGACGTGGTGGTGG + Intronic
1179338743 21:40484223-40484245 AGAATTGTGAAAGGTGGAAGTGG + Intronic
1181667730 22:24410021-24410043 AAAATTTTAAAAAGTTGAGGTGG + Intronic
1182862153 22:33569537-33569559 AAAATTAAGAAATTTGGTGGTGG + Intronic
1184317824 22:43710957-43710979 AAAATTAAGAAATGGAGAGGAGG + Intronic
950767708 3:15285768-15285790 GGAAGTCTGAAACGTGGAGGAGG - Intronic
950924436 3:16726538-16726560 AAAATTATGAAAACTGAAAGTGG + Intergenic
952007060 3:28854171-28854193 AAAAAAAAAAAACGTGGAGGAGG - Intergenic
953396143 3:42572046-42572068 AAAATTCTGAAAGGTGGAGAAGG + Intronic
953713132 3:45292075-45292097 AAAATTATGACACATGGTGTGGG - Intergenic
955787178 3:62552966-62552988 AAAATTCTGAAAGGGGAAGGAGG + Intronic
956004261 3:64762067-64762089 AATATTTTGAGAGGTGGAGGAGG - Intergenic
957208754 3:77233315-77233337 AAAAATAAAAAAAGTGGAGGGGG - Intronic
957608642 3:82437864-82437886 AAAATAATGTCACATGGAGGTGG - Intergenic
957843919 3:85705848-85705870 AAAAATATTAAACGGTGAGGGGG - Intronic
958918939 3:100081154-100081176 AGGATTATGAACCATGGAGGTGG - Intronic
959458236 3:106590839-106590861 AAAATTATGTAATGTAGAAGAGG - Intergenic
960162493 3:114365590-114365612 AAAAAGATGAAACAAGGAGGAGG + Intronic
960329941 3:116346614-116346636 AAAATTCTGTAATGTGGTGGTGG - Intronic
961507606 3:127380971-127380993 AAAATTGTAAAAGGAGGAGGTGG + Intergenic
962742535 3:138372352-138372374 AGAATTCTGAAACTTGGAAGGGG + Intronic
964167849 3:153730501-153730523 AAAATTAGAAAACATGGAGATGG + Intergenic
965855798 3:173086484-173086506 AAATTTATGAATCCAGGAGGTGG - Intronic
965917202 3:173864446-173864468 AAAATTATTACACGTTGAAGGGG + Intronic
966389110 3:179432902-179432924 AAAAATATGGAAAGTGGAGGGGG + Intronic
966700534 3:182845089-182845111 AATTTTTTGAACCGTGGAGGCGG - Intronic
969834227 4:9826367-9826389 ATAATTGTCCAACGTGGAGGAGG + Exonic
970387818 4:15573662-15573684 AAAATTCTGAAAAATGGAGATGG + Intronic
970802787 4:19994718-19994740 AAAATTATACAACATGAAGGGGG - Intergenic
971051360 4:22866436-22866458 AAAATTACGGAAAGTGAAGGAGG + Intergenic
971241184 4:24890366-24890388 AAAATTATGAAGCTTGTAAGAGG + Intronic
974860500 4:67515163-67515185 TAAATTATAAAAAGTTGAGGAGG + Intronic
976453052 4:85214568-85214590 AAATTTATGAAATTTGGAGTTGG - Intergenic
981867834 4:149446810-149446832 AAAACTATGAAACCTGAAGATGG + Intergenic
984389427 4:179109989-179110011 AAAATTATTGAACCTGAAGGGGG - Intergenic
986135207 5:4970655-4970677 AACATTATGAGATTTGGAGGGGG + Intergenic
987425971 5:17772832-17772854 AAAATGTTGAAATGTGGAGAAGG - Intergenic
987955307 5:24730911-24730933 AAAAATATCAAATGTGGCGGGGG + Intergenic
988556713 5:32242802-32242824 CAAATTATGAGACGTGTAGCAGG + Intronic
989440826 5:41471082-41471104 AAAATTATGAAGAGGGGAGAGGG + Intronic
989822761 5:45815102-45815124 AAAATTATAAAACCAGGAGAAGG + Intergenic
994133450 5:96258526-96258548 AAAATTTTGAAAGGGTGAGGAGG - Intergenic
994553597 5:101267532-101267554 AAAATTGAGAAACTTAGAGGAGG - Intergenic
994727009 5:103448148-103448170 AGAATTATGAACCCAGGAGGTGG - Intergenic
995230166 5:109752196-109752218 GTAATTATGAAATATGGAGGAGG - Intronic
995714320 5:115067231-115067253 AAAATGATGATACGTAGTGGAGG - Intergenic
996633613 5:125665526-125665548 AAAATTATAAAAATTAGAGGAGG - Intergenic
997009989 5:129865208-129865230 AAAATTATAAATACTGGAGGTGG + Intergenic
997620840 5:135292606-135292628 AAAATTTTGAAACTGGGAAGTGG + Intronic
997706079 5:135953904-135953926 AAAATTATGAAACGTGGAGGAGG + Intronic
1000180109 5:158800869-158800891 AATATTATGGAATGTGGGGGCGG + Intronic
1000531837 5:162431938-162431960 AAAATTATGACACACGGTGGGGG - Intergenic
1000542730 5:162560288-162560310 AAAATTATGAAGCTGGGTGGAGG - Intergenic
1005049454 6:21670624-21670646 AAAATCCAGTAACGTGGAGGAGG - Intergenic
1007215454 6:40234179-40234201 AAAATGATAAAAGGGGGAGGTGG + Intergenic
1008488079 6:52056567-52056589 AAAAATATGAAACCTGGATTTGG - Intronic
1008786286 6:55172810-55172832 AAAATTATGATTGGAGGAGGGGG + Intronic
1008852860 6:56045693-56045715 AAAATTGTAAAATGAGGAGGTGG + Intergenic
1010434930 6:75818047-75818069 AAAAATATGAAAAGTGAATGTGG + Intronic
1011354625 6:86461407-86461429 AAAAGTATGAGAGGAGGAGGAGG + Intergenic
1012103184 6:95117982-95118004 AAAATTAAGAACCCTGGAAGAGG + Intergenic
1012998176 6:105993998-105994020 TAATTTATGAAACGTGAACGGGG + Intergenic
1014457066 6:121648185-121648207 AAAAGTAGGAAACATGAAGGAGG + Intergenic
1015411396 6:132897720-132897742 AAAATTATGACAAGTGGAGGAGG + Intergenic
1015498352 6:133904596-133904618 AATATTATGGAATGTGGAGAAGG - Intergenic
1016061158 6:139632030-139632052 AATATTATGAAAAATAGAGGAGG - Intergenic
1016082018 6:139867633-139867655 AAAATACTGATACGGGGAGGGGG - Intergenic
1016690589 6:146933506-146933528 AAAAATATGGAAAGTAGAGGAGG - Intergenic
1018544148 6:164917242-164917264 AAAATTTTTAAATGTGGAGAGGG - Intergenic
1018556617 6:165057584-165057606 AAAATTAGCAAGCGTGGTGGCGG + Intergenic
1018938716 6:168293452-168293474 AAAATTATGAAATATAGAAGGGG + Intronic
1020330689 7:7013942-7013964 CAAATTATCAAACATGGAGAGGG + Intergenic
1022028298 7:26468662-26468684 ATGATGATGAAACTTGGAGGAGG + Intergenic
1022189504 7:28003690-28003712 AAAATTTTGGCAGGTGGAGGTGG - Intronic
1022196752 7:28075479-28075501 AAAATCAGGAAAAGTGGAGATGG - Intronic
1023314214 7:38918484-38918506 TAAATATTGAAAAGTGGAGGAGG - Intronic
1027761324 7:82282690-82282712 AAAATTGTAAAATGTGGGGGGGG + Intronic
1027977857 7:85181822-85181844 AAAATTATGAAACATGAACATGG + Intronic
1028440320 7:90852142-90852164 AGCATTTTGAAAGGTGGAGGTGG - Intronic
1028728948 7:94122652-94122674 AAAATTATGAGACTTTGAGCGGG - Intergenic
1030211652 7:107002439-107002461 AAAATTATGAAACCTGATAGAGG + Intergenic
1030583183 7:111385143-111385165 AAAATAAGGCAAGGTGGAGGTGG + Intronic
1031929211 7:127667391-127667413 AAAATGATAAAACGTGGTAGGGG - Intronic
1032480411 7:132241607-132241629 AAAATGACGAAACTTGAAGGAGG - Intronic
1033110277 7:138567484-138567506 AAGTTTATCAAACGTGGAGGCGG - Exonic
1033633584 7:143186416-143186438 AGAAAAATGAAACTTGGAGGAGG - Intergenic
1033779845 7:144655762-144655784 AAAATTAAGAAAAGTGAAGTGGG + Intronic
1034173397 7:149080903-149080925 AGCATAATGAAACGTGGAGCGGG - Intronic
1036491230 8:9227417-9227439 AAAATTACGAAAAGTGGAAGAGG - Intergenic
1037157072 8:15715320-15715342 TAAATTATGTTACGTGGATGTGG + Intronic
1038754253 8:30326125-30326147 AAAACTAGGAAAGGTGGATGTGG + Intergenic
1040042777 8:42933154-42933176 AAAATTATGAAACATGTTGTAGG + Intronic
1041976932 8:63810131-63810153 AAAATTATAAAACCTGGTGCTGG + Intergenic
1042844421 8:73156090-73156112 AGAATTATGAAAAATGGAAGGGG - Intergenic
1043239971 8:77920420-77920442 TAAATTATAAAACATGGGGGAGG - Intergenic
1043991556 8:86762087-86762109 AAAATTACTGAACCTGGAGGTGG - Intergenic
1044139859 8:88637045-88637067 AAAATTATCAAACATGAAGGTGG + Intergenic
1044818183 8:96134272-96134294 AAAATTATGACCCATGGTGGGGG - Intergenic
1046298984 8:112260715-112260737 AAAATTCTGACTCATGGAGGAGG - Intronic
1046348827 8:112976829-112976851 CAAATTATGAAATTTGGAAGTGG + Intronic
1048398194 8:134035301-134035323 AAAAGTAAGAAAAGAGGAGGGGG + Intergenic
1050840932 9:10148075-10148097 AAAATAGTGAAAGGTGGTGGTGG - Intronic
1051121538 9:13757449-13757471 AAAATATTGCAACGGGGAGGAGG - Intergenic
1052234250 9:26190684-26190706 AAAATTATAAAATGTGGGGAAGG + Intergenic
1052248489 9:26368306-26368328 AAAAATTTGAAACGTGGAACTGG + Intergenic
1052908099 9:33854870-33854892 AAAATAAAAAAATGTGGAGGTGG - Intronic
1055604510 9:77954531-77954553 GAAATTATGAGGCATGGAGGAGG - Intronic
1058509444 9:105701029-105701051 AAAATTTAGAAACTTGGTGGAGG - Intronic
1059715228 9:116907153-116907175 CAAAGTGTGAAACGTGGAGTAGG + Intronic
1059934368 9:119294228-119294250 AAAATTATAAAACGTTGATGAGG + Intronic
1060149189 9:121276756-121276778 AAGATTAAGAAACCTGGTGGTGG + Intronic
1060601985 9:124884452-124884474 ACAATTAGGAAAGCTGGAGGAGG - Intronic
1186724659 X:12344427-12344449 AAGATTTTAAAAAGTGGAGGAGG - Intronic
1187174361 X:16882811-16882833 GAAATGAAGAACCGTGGAGGCGG - Intergenic
1187210168 X:17222368-17222390 AGAATAATGATATGTGGAGGTGG + Intergenic
1187750969 X:22464461-22464483 AAAACTATGAAACTTTGTGGTGG + Intergenic
1189686231 X:43566228-43566250 AAACTTATGAAATGTTAAGGTGG - Intergenic
1190072659 X:47291804-47291826 AAAATTACAAAACTTAGAGGAGG - Intergenic
1190417180 X:50191498-50191520 AAAAGTATGAGACTTGGAGTAGG + Intronic
1191165558 X:57386472-57386494 AAAATTATGAAGCCAGGAGCAGG + Intronic
1192596154 X:72410463-72410485 AAGATTATGAAAAGTAGAGTAGG + Intronic
1192623627 X:72705052-72705074 AAAATTTTGAAAATTGGAGAGGG - Intronic
1192676875 X:73206130-73206152 AACATTATGGAAAGTGGAGGTGG + Intergenic
1194801701 X:98281540-98281562 TAAATTATGAAGCCTGGGGGTGG + Intergenic
1194842803 X:98764938-98764960 ATAAATATGAGAAGTGGAGGTGG + Intergenic
1195756289 X:108202200-108202222 AAAGTGATGAAATGTGGATGGGG - Intronic
1195760504 X:108240901-108240923 TAACTTATGAAAAATGGAGGGGG + Intronic
1197274018 X:124456974-124456996 AAAATTTTTAAACCTGGAAGTGG - Intronic
1197732287 X:129821440-129821462 AAAATTAGGGGACGTGGTGGTGG - Intronic
1197875328 X:131097664-131097686 AAAACTCTGAAAAGTGGAAGAGG - Intergenic
1198262400 X:134976705-134976727 AAAAGTATGAACCTGGGAGGTGG - Intergenic
1200056093 X:153462168-153462190 AAAATTTAGAAACGAGAAGGTGG + Intronic
1200362416 X:155622684-155622706 AATATGAAGAAACTTGGAGGGGG - Intronic