ID: 997709725

View in Genome Browser
Species Human (GRCh38)
Location 5:135993881-135993903
Sequence AAACTTTTATTTGCGAGGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997709725_997709730 1 Left 997709725 5:135993881-135993903 CCTTTCCTCGCAAATAAAAGTTT No data
Right 997709730 5:135993905-135993927 TGAGGCTGCAAGCCCATGGGAGG No data
997709725_997709734 21 Left 997709725 5:135993881-135993903 CCTTTCCTCGCAAATAAAAGTTT No data
Right 997709734 5:135993925-135993947 AGGCCACTGTCAAAGGCCCCAGG No data
997709725_997709735 22 Left 997709725 5:135993881-135993903 CCTTTCCTCGCAAATAAAAGTTT No data
Right 997709735 5:135993926-135993948 GGCCACTGTCAAAGGCCCCAGGG No data
997709725_997709733 14 Left 997709725 5:135993881-135993903 CCTTTCCTCGCAAATAAAAGTTT No data
Right 997709733 5:135993918-135993940 CCATGGGAGGCCACTGTCAAAGG No data
997709725_997709728 -3 Left 997709725 5:135993881-135993903 CCTTTCCTCGCAAATAAAAGTTT No data
Right 997709728 5:135993901-135993923 TTTCTGAGGCTGCAAGCCCATGG No data
997709725_997709729 -2 Left 997709725 5:135993881-135993903 CCTTTCCTCGCAAATAAAAGTTT No data
Right 997709729 5:135993902-135993924 TTCTGAGGCTGCAAGCCCATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997709725 Original CRISPR AAACTTTTATTTGCGAGGAA AGG (reversed) Intergenic
No off target data available for this crispr