ID: 997709726

View in Genome Browser
Species Human (GRCh38)
Location 5:135993886-135993908
Sequence CTCAGAAACTTTTATTTGCG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997709726_997709729 -7 Left 997709726 5:135993886-135993908 CCTCGCAAATAAAAGTTTCTGAG No data
Right 997709729 5:135993902-135993924 TTCTGAGGCTGCAAGCCCATGGG No data
997709726_997709730 -4 Left 997709726 5:135993886-135993908 CCTCGCAAATAAAAGTTTCTGAG No data
Right 997709730 5:135993905-135993927 TGAGGCTGCAAGCCCATGGGAGG No data
997709726_997709728 -8 Left 997709726 5:135993886-135993908 CCTCGCAAATAAAAGTTTCTGAG No data
Right 997709728 5:135993901-135993923 TTTCTGAGGCTGCAAGCCCATGG No data
997709726_997709735 17 Left 997709726 5:135993886-135993908 CCTCGCAAATAAAAGTTTCTGAG No data
Right 997709735 5:135993926-135993948 GGCCACTGTCAAAGGCCCCAGGG No data
997709726_997709733 9 Left 997709726 5:135993886-135993908 CCTCGCAAATAAAAGTTTCTGAG No data
Right 997709733 5:135993918-135993940 CCATGGGAGGCCACTGTCAAAGG No data
997709726_997709734 16 Left 997709726 5:135993886-135993908 CCTCGCAAATAAAAGTTTCTGAG No data
Right 997709734 5:135993925-135993947 AGGCCACTGTCAAAGGCCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997709726 Original CRISPR CTCAGAAACTTTTATTTGCG AGG (reversed) Intergenic
No off target data available for this crispr