ID: 997709733

View in Genome Browser
Species Human (GRCh38)
Location 5:135993918-135993940
Sequence CCATGGGAGGCCACTGTCAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997709724_997709733 15 Left 997709724 5:135993880-135993902 CCCTTTCCTCGCAAATAAAAGTT No data
Right 997709733 5:135993918-135993940 CCATGGGAGGCCACTGTCAAAGG No data
997709725_997709733 14 Left 997709725 5:135993881-135993903 CCTTTCCTCGCAAATAAAAGTTT No data
Right 997709733 5:135993918-135993940 CCATGGGAGGCCACTGTCAAAGG No data
997709723_997709733 16 Left 997709723 5:135993879-135993901 CCCCTTTCCTCGCAAATAAAAGT No data
Right 997709733 5:135993918-135993940 CCATGGGAGGCCACTGTCAAAGG No data
997709726_997709733 9 Left 997709726 5:135993886-135993908 CCTCGCAAATAAAAGTTTCTGAG No data
Right 997709733 5:135993918-135993940 CCATGGGAGGCCACTGTCAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997709733 Original CRISPR CCATGGGAGGCCACTGTCAA AGG Intergenic
No off target data available for this crispr