ID: 997717009

View in Genome Browser
Species Human (GRCh38)
Location 5:136049881-136049903
Sequence GAATAGCCAAGGCCAGAGCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 281
Summary {0: 1, 1: 0, 2: 1, 3: 50, 4: 229}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997717004_997717009 8 Left 997717004 5:136049850-136049872 CCTGGCCAGAAACAGGGAGAGTG 0: 1
1: 1
2: 3
3: 25
4: 297
Right 997717009 5:136049881-136049903 GAATAGCCAAGGCCAGAGCAAGG 0: 1
1: 0
2: 1
3: 50
4: 229
997717005_997717009 3 Left 997717005 5:136049855-136049877 CCAGAAACAGGGAGAGTGAAAGG 0: 1
1: 0
2: 1
3: 24
4: 390
Right 997717009 5:136049881-136049903 GAATAGCCAAGGCCAGAGCAAGG 0: 1
1: 0
2: 1
3: 50
4: 229
997717000_997717009 19 Left 997717000 5:136049839-136049861 CCATAGCTGGCCCTGGCCAGAAA 0: 1
1: 0
2: 2
3: 18
4: 211
Right 997717009 5:136049881-136049903 GAATAGCCAAGGCCAGAGCAAGG 0: 1
1: 0
2: 1
3: 50
4: 229
997716999_997717009 20 Left 997716999 5:136049838-136049860 CCCATAGCTGGCCCTGGCCAGAA 0: 1
1: 0
2: 1
3: 12
4: 124
Right 997717009 5:136049881-136049903 GAATAGCCAAGGCCAGAGCAAGG 0: 1
1: 0
2: 1
3: 50
4: 229
997717003_997717009 9 Left 997717003 5:136049849-136049871 CCCTGGCCAGAAACAGGGAGAGT 0: 1
1: 0
2: 2
3: 27
4: 218
Right 997717009 5:136049881-136049903 GAATAGCCAAGGCCAGAGCAAGG 0: 1
1: 0
2: 1
3: 50
4: 229

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997717009 Original CRISPR GAATAGCCAAGGCCAGAGCA AGG Intronic
900491870 1:2953491-2953513 GAATATCAAAGCCCAGAGAAGGG + Intergenic
900505184 1:3026781-3026803 GAAGGGCCAAGGCCAGGGGATGG + Intergenic
900561895 1:3311320-3311342 GACGAGCCAAGGCCAGAGTTGGG + Intronic
900630943 1:3634822-3634844 GAAGAACAAAGGCCAGGGCAGGG + Intronic
901013307 1:6213041-6213063 GTGGGGCCAAGGCCAGAGCATGG - Intronic
902697910 1:18152822-18152844 GCAGAGCTAAGGCCAGATCATGG - Intronic
902752124 1:18524032-18524054 AAATAGCCAAGGCCAGATCATGG + Intergenic
903231352 1:21924209-21924231 GAATAGCCAGGCGCAGAGGAAGG + Intronic
903535426 1:24063407-24063429 CAATAGCCAAGGCCAGTGTTAGG + Intronic
904283650 1:29439234-29439256 GAAGACCCACGGCCTGAGCATGG - Intergenic
905184727 1:36188102-36188124 GACTAGGCAGGGCCAGAGGAAGG + Intergenic
905951913 1:41959023-41959045 GGATAGCCAAGGACAGAGGCCGG - Intronic
908299876 1:62753381-62753403 GGCTGGCCAAGGCCAGAGCTGGG + Intergenic
909350925 1:74652599-74652621 CAATCACCAAGCCCAGAGCAAGG - Intronic
910897898 1:92087023-92087045 GAATAGTAAAGTCCAGAGGAAGG - Intronic
913957404 1:143318475-143318497 GCAAAGCCAAGGCCAGGGCAGGG + Intergenic
914051718 1:144143839-144143861 GCAAAGCCAAGGCCAGGGCAGGG + Intergenic
914127479 1:144822702-144822724 GCAAAGCCAAGGCCAGGGCAGGG - Intergenic
916298412 1:163246273-163246295 GAATAGCCAAGCACAGGGCCAGG + Intronic
917692356 1:177482459-177482481 CCATAGCTAAGGACAGAGCAAGG - Intergenic
920092361 1:203463768-203463790 GTAGAGTCAAGGCCAGACCAGGG + Intergenic
920232939 1:204482268-204482290 GAATAGCCAAGGCCAGGGTTTGG - Intronic
922504322 1:226117889-226117911 TGACAGCCAAGGCCAGAGGAGGG + Intergenic
924266449 1:242286927-242286949 GAATTGCTATGGCCAGAGAATGG + Intronic
924309205 1:242722409-242722431 GAGGAGCCAAGGCCGGGGCAGGG - Intergenic
1065200948 10:23312466-23312488 GAGTAGCCAACTCCAGGGCAGGG - Intronic
1066201001 10:33142530-33142552 GAAGAGACAAGGCCAGAGCCAGG + Intergenic
1066760254 10:38742097-38742119 GCAAAGCCGAGGCCAGGGCAGGG - Intergenic
1066961353 10:42230671-42230693 GCAAAGCCAAGGCCAGGGCAGGG + Intergenic
1066962338 10:42234457-42234479 GCAAAGGCAGGGCCAGAGCAAGG + Intergenic
1067796402 10:49325222-49325244 GAATTGCCAAGGCCAGAATGGGG + Exonic
1068020807 10:51581421-51581443 GAATAGCCATGGCAAGATGAGGG + Intronic
1068600445 10:58951197-58951219 AAACATCCAAGGCCAGACCAAGG - Intergenic
1069374565 10:67781022-67781044 GTATAACCAACGCCATAGCATGG + Intergenic
1072777530 10:98214284-98214306 GCACTGCCAAGGACAGAGCAAGG - Intronic
1074409914 10:113219389-113219411 AAAGAGCCGAGGCAAGAGCAAGG + Intergenic
1074937620 10:118201091-118201113 CAATAGCCAAGGCCTAAGAAGGG - Intergenic
1075534903 10:123262665-123262687 GAATAGCCAAAGCAGGAGTAGGG - Intergenic
1075701244 10:124470513-124470535 GAACAGCGAAGGCCAGGGCCAGG + Intronic
1075923572 10:126233182-126233204 GAACAGCCAAGGGCAGAACCCGG + Intronic
1077399555 11:2347235-2347257 CAACAGCCATGGCCTGAGCAGGG + Intergenic
1079132427 11:17755146-17755168 GAACAGCCAGTGCAAGAGCATGG + Intronic
1079782863 11:24630647-24630669 GAATAGCCAAAGCCATTACAAGG - Intronic
1080795695 11:35560984-35561006 AAATAGCCAAGGACAAAGCAGGG + Intergenic
1081620609 11:44617120-44617142 GGATAGCCACGGTCACAGCAGGG - Intronic
1081807953 11:45900353-45900375 CCAGAGCCAAGGCCAGAGCCAGG + Exonic
1083294725 11:61709116-61709138 GAATGGCCAAGGAGAGAGCCTGG - Intronic
1084433883 11:69126840-69126862 GAACAGCCAAGACTAGAGCCAGG - Intergenic
1084667038 11:70582075-70582097 GAAGAGCTGAGGCCAGAGGAGGG + Intronic
1089402468 11:118172178-118172200 GCATGGCCAAGGCCACAGAAAGG + Intronic
1090944888 11:131420947-131420969 GAAAGGCCAAGGCTAGAGAATGG - Intronic
1091524379 12:1283246-1283268 GAAAAGCTCAGGCCAGAGCTGGG - Intronic
1091750467 12:3018821-3018843 GTATAGGCAGGGCCAGAGCTGGG + Intronic
1096470150 12:51870440-51870462 GCAAAGCCAAGGCCAGAGGTGGG - Intergenic
1098384857 12:69907961-69907983 GAATGGTTAAGGCCAGAGCAGGG - Intronic
1102203563 12:111074953-111074975 GAACAGGCAGGGGCAGAGCAAGG - Intronic
1103340629 12:120219433-120219455 GAGAGGCCAAGGCCAGAGCCAGG - Intronic
1103952329 12:124557968-124557990 GAAAAGCCCAGGCCAGGGCCTGG + Intronic
1106289614 13:28348466-28348488 AAATAGCAAAAGCCAAAGCATGG - Intronic
1106415006 13:29539131-29539153 GAAAAGCCCAGGACAGAGAAAGG - Intronic
1109864368 13:68243539-68243561 GAAAAGCCAAGGATAGAGAAAGG - Intergenic
1110404103 13:75129511-75129533 GCATAGCCATGGCAGGAGCAGGG + Intergenic
1110767628 13:79299027-79299049 AAATAGCAAAGTTCAGAGCATGG - Intergenic
1111238463 13:85441396-85441418 GAGTGGCTAAAGCCAGAGCATGG - Intergenic
1113113437 13:106848972-106848994 GATTAGGCAAGGCCAGAGCCAGG - Intergenic
1113302027 13:109032730-109032752 GAATATCCAAGACTACAGCATGG - Intronic
1113480541 13:110616510-110616532 GACCAGCCAAGGCCAGGGCAGGG - Intronic
1115382326 14:32755094-32755116 GAATAAGCAAAGCCAGAGAAGGG - Intronic
1116040240 14:39677632-39677654 GAATAGCATAGGCCAGAGGAGGG - Intergenic
1118465243 14:66024778-66024800 GTATAGAAAAGGGCAGAGCACGG - Intergenic
1119332045 14:73802239-73802261 GACCTGCCCAGGCCAGAGCAAGG - Intergenic
1120477693 14:85008866-85008888 TCATAGCCAATGCCAGAGAAAGG - Intergenic
1122090296 14:99334088-99334110 GGCTTGGCAAGGCCAGAGCACGG + Intergenic
1202930978 14_KI270725v1_random:31615-31637 GCAAAGCCAAGGCCAGTGCAGGG - Intergenic
1123421463 15:20140108-20140130 GCAAAGCCAAGGCCAGGGCAGGG + Intergenic
1123443670 15:20306712-20306734 GCAAAGCCAAGGCCAGGGCAGGG - Intergenic
1123530689 15:21146648-21146670 GCAAAGCCAAGGCCAGGGCAGGG + Intergenic
1123853526 15:24383891-24383913 GAAGTGCCATGGCCAGAGCAAGG - Intergenic
1123869493 15:24556496-24556518 GAAGTGCCATGGCCGGAGCAAGG - Intergenic
1124778597 15:32608516-32608538 CATTAGCCTAGGCCTGAGCAGGG - Intergenic
1126136812 15:45400693-45400715 GAATAACCAAAGCCAAAACAGGG - Intronic
1127052609 15:55100547-55100569 GTACAGCCCAGGGCAGAGCAGGG - Intergenic
1130608078 15:85335444-85335466 CAAGAGCAAGGGCCAGAGCAAGG + Intergenic
1130657057 15:85799094-85799116 GAGTGGCCCAGGCCAGACCAGGG - Intergenic
1131247583 15:90808904-90808926 GCATAGGCCAGGGCAGAGCAAGG - Intronic
1131594612 15:93784356-93784378 GAAGAGGCAGGGCCAGATCATGG + Intergenic
1132439456 15:101844481-101844503 GAATACACAAGGCTAGAGAAAGG - Intergenic
1132473075 16:117769-117791 GGACAGCCAAGCCCTGAGCAGGG + Intronic
1133707709 16:8370951-8370973 GCATAGCCAAGGCCATTGGAAGG - Intergenic
1133850690 16:9500505-9500527 CAGCAGCCCAGGCCAGAGCAAGG - Intergenic
1136722540 16:32337179-32337201 GCAAAGCCAAGGCCAGGGCAGGG + Intergenic
1136840864 16:33543172-33543194 GCAAAGCCAAGGCCAGGGCAGGG + Intergenic
1137406405 16:48192844-48192866 GAGTAGCCAAGCGCTGAGCAGGG - Intronic
1137598189 16:49738607-49738629 GGATAGGGGAGGCCAGAGCAGGG + Intronic
1138267742 16:55671928-55671950 GCATAGCCAACGCCTGGGCAGGG - Exonic
1139950333 16:70665217-70665239 TCACAGCCAAGGGCAGAGCATGG + Intronic
1142419742 16:89963033-89963055 GAGTTGCCAAGGCCAGGGCTGGG + Intronic
1203003891 16_KI270728v1_random:180585-180607 GCAAAGCCAAGGCCAGGGCAGGG - Intergenic
1203123974 16_KI270728v1_random:1560238-1560260 GCAAAGGCAGGGCCAGAGCAAGG - Intergenic
1203135499 16_KI270728v1_random:1716992-1717014 GCAAAGCCAAGGCCAGGGCAGGG - Intergenic
1203151029 16_KI270728v1_random:1843469-1843491 GCAAAGCCAAGGCCAGGGCAGGG + Intergenic
1146053952 17:29572144-29572166 GCAGAGCAAAGGCCAGAGCCAGG - Exonic
1147238897 17:39077613-39077635 TAATAGCCCAGGCCAGTGCCAGG - Intronic
1147978004 17:44258969-44258991 GACGAGACCAGGCCAGAGCAGGG + Intronic
1148180611 17:45602124-45602146 CCAGAGCCAAGGCCAGAGCCAGG - Intergenic
1148268291 17:46243791-46243813 CCAGAGCCAAGGCCAGAGCCAGG + Intergenic
1151172056 17:72255119-72255141 AAATAGTCAAGACCAGAACATGG + Intergenic
1151292061 17:73157441-73157463 GAATAGCTAAGGACGGAGCCAGG + Intergenic
1151353756 17:73546457-73546479 GAACAGCCTTGGCCAGAGAAGGG + Intronic
1151386077 17:73756228-73756250 GGATAGCTAAGGCAAGAGCTTGG - Intergenic
1152645750 17:81467837-81467859 GAAAAGCCCAGGGCAGGGCAGGG + Intergenic
1153499254 18:5731350-5731372 GAATGGCTAAAGACAGAGCATGG - Intergenic
1155680669 18:28482210-28482232 AAGTTGCCAAGGCCATAGCAAGG + Intergenic
1156239659 18:35240888-35240910 GAATCTCCAAGGCCAGGGGAGGG - Intergenic
1157305957 18:46517991-46518013 GAATAGACAAAGGCAGAGGAAGG + Intronic
1157575315 18:48739479-48739501 GCAGAGCCAGGGCCAGAGCAGGG - Intronic
1157969268 18:52247662-52247684 GAAAAGCCAATGACTGAGCAAGG + Intergenic
1158865309 18:61632645-61632667 AAAAAGCCAAGGGCAGAGGAAGG - Intergenic
1158875741 18:61733071-61733093 CCATGGCCATGGCCAGAGCAGGG - Intergenic
1160331848 18:78000578-78000600 GGATATCCATGGGCAGAGCAAGG - Intergenic
1160973941 19:1783273-1783295 GAAGAGCAAAGGGGAGAGCAGGG + Intronic
1161390155 19:4016487-4016509 GCATTGCCCAGGCCACAGCAAGG + Intronic
1161699217 19:5785764-5785786 GAAGAGCCACGGCTTGAGCAGGG + Exonic
1163294802 19:16405213-16405235 GAAGAGCCAGGGACAGAGCCTGG + Intronic
1164618379 19:29679956-29679978 GGATAGACAAAGCCAGAGAAAGG + Intergenic
1165069534 19:33247648-33247670 TAACAGCCCAGGCCAGAGCCAGG - Intergenic
1165784376 19:38452639-38452661 CAATGGCCAAGGGCAGAGCTGGG - Intronic
1168511397 19:56976615-56976637 TAATAGCCAAGGACAGAGGCAGG + Intergenic
1202691114 1_KI270712v1_random:96263-96285 GCAAAGCCAAGGCCAGGGCAGGG + Intergenic
926694997 2:15764892-15764914 GGAGTGCCAAGGCCAGAGAAGGG - Intergenic
928898656 2:36293959-36293981 GAGTTGCCAAGTGCAGAGCAAGG - Intergenic
933650614 2:84847121-84847143 GAGGAGCCAAGTCCAGGGCAGGG + Intronic
933955279 2:87357688-87357710 GCAAAGCCAAGGCCAGGGCAGGG - Intergenic
934239467 2:90253901-90253923 GCAAAGCCAAGGCCAGGGCAGGG - Intergenic
934247126 2:90317201-90317223 GACTACCCATGGCCAGACCAAGG + Intergenic
934262201 2:91485402-91485424 GACTACCCATGGCCAGACCAAGG - Intergenic
934273718 2:91562797-91562819 GCAAAGCCAAGGCCAGGGCAGGG + Intergenic
934323446 2:91985975-91985997 GCAGAGTCAAGGCCAGAACAAGG - Intergenic
934323566 2:91986422-91986444 GCAAAGCCAAGGCCAGGGCAGGG - Intergenic
934461911 2:94217255-94217277 GCAAAGCCAAGGCCAGGGTAGGG - Intergenic
935192533 2:100790295-100790317 GAATGTCCAAGCCCACAGCATGG + Intergenic
935495905 2:103781479-103781501 CAAGAGCCAAAGCCAGAGAAAGG - Intergenic
936334375 2:111576190-111576212 CAATATCCAAGGAGAGAGCAAGG - Intergenic
937150861 2:119684719-119684741 GACTTGCCAAGGACAGAGCCTGG + Intronic
939343440 2:140930777-140930799 GAAAAGCTAAGAACAGAGCAAGG - Intronic
940603404 2:155889065-155889087 TAATAGTCAATGGCAGAGCAGGG + Intergenic
943515451 2:188880340-188880362 GAATAAGCAAGGAGAGAGCAAGG + Intergenic
944871644 2:203918246-203918268 GATTAGCCAAGGTGTGAGCAGGG + Intergenic
944926272 2:204468019-204468041 GTAAAGCCATGGCCAAAGCAGGG + Intergenic
945331718 2:208547625-208547647 GAATAGACAAGGTCATAGAAAGG + Intronic
945420693 2:209632597-209632619 GGATGGGCATGGCCAGAGCATGG - Intronic
946155228 2:217802612-217802634 GGAAGGCCAAGGCCAGGGCAAGG + Exonic
947454827 2:230244553-230244575 GCATTTCCATGGCCAGAGCAGGG + Intronic
947745856 2:232506934-232506956 GATGAGCCAGGCCCAGAGCAAGG + Intergenic
948526919 2:238576430-238576452 GAAGAGCCAAGGGCTGAGCTCGG - Intergenic
948866531 2:240777799-240777821 GAGGAGCCAGGCCCAGAGCAGGG - Intronic
1169177872 20:3534352-3534374 TAATAGCAAGGGCCAGAGAAGGG + Intronic
1171210195 20:23310707-23310729 GGATAGCCAGGGCCAGGGAAGGG - Intergenic
1171390073 20:24795551-24795573 GAACAGCCATGTCCAGGGCATGG + Intergenic
1172650079 20:36496585-36496607 GAATGGCTAAGCCCAGAGCTAGG + Intronic
1174254941 20:49247541-49247563 GAGATGCCCAGGCCAGAGCAGGG + Exonic
1174954877 20:55086526-55086548 GAATCAAGAAGGCCAGAGCATGG + Intergenic
1176592999 21:8660237-8660259 GCAAAGCCAAGGCCAGGGCAGGG - Intergenic
1178269191 21:31174285-31174307 GAATTGCCAAGTGCTGAGCACGG - Intronic
1179532438 21:42029030-42029052 GAAAAGCCAAGGGCACAGCAGGG - Intergenic
1180275846 22:10637364-10637386 GCAAAGCCAAGGCCAGGGCAGGG - Intergenic
1180550333 22:16532309-16532331 GCAAAGCCAAGGCCAGGGCAGGG - Intergenic
1181354339 22:22289514-22289536 GCAAAGCCAAGGCCAGGGCAGGG + Intergenic
1182318215 22:29461885-29461907 CAAGAGCGAAGGCCAGAGCGGGG + Intergenic
1182360722 22:29744893-29744915 GAATACCCACTGCAAGAGCATGG - Intronic
1182736860 22:32537047-32537069 CAATAGCAATGGACAGAGCATGG - Intronic
1182816359 22:33167744-33167766 CAAAAGCCAAGGGCAGAGCTTGG - Intronic
1183587405 22:38760863-38760885 AAAAAGCCAAGACCAGAGCAGGG - Intronic
1184053576 22:42027891-42027913 GAATAACCAAGGCAATAGCATGG + Exonic
1184719145 22:46299364-46299386 GAATATACAAGCCCAGAGCTCGG - Intronic
1184722678 22:46324253-46324275 GAAGAGCAAAGACCAGAGCCAGG + Intronic
1185020779 22:48373665-48373687 GAAGAGCCCAGGCCACAGGAAGG + Intergenic
1185045844 22:48528383-48528405 GTATAGCCAAGGCCATAGTGAGG + Intronic
950704148 3:14769704-14769726 GGAGAGACAAGGCCAGATCAAGG + Intronic
950717929 3:14862873-14862895 GCTCTGCCAAGGCCAGAGCAGGG - Intronic
951736686 3:25873982-25874004 GTAAAGCCAAGCCCAGAGTAAGG + Intergenic
953083624 3:39645228-39645250 TAAAAGCCAAGGCAAGAGCGGGG - Intergenic
953171223 3:40509608-40509630 AACTAACCAAGGCCAGAGAAAGG - Intronic
954653127 3:52177449-52177471 AAAAAGGCAAGGCCAGAGCTTGG - Intergenic
954713969 3:52518025-52518047 GCACAGCCAAGACCAGATCAGGG - Intronic
955355121 3:58224820-58224842 AAAAAGCCAGGTCCAGAGCAGGG + Intergenic
956719821 3:72107953-72107975 GAAGTGCCAAGGCCAGGGCCCGG + Intergenic
958949710 3:100403022-100403044 GAATAGCATAGGCTAGAGAATGG - Intronic
961457192 3:127030119-127030141 AAAGTGCCAAGCCCAGAGCAAGG + Intronic
961726812 3:128936169-128936191 GAATGGCATAGGCCAGTGCAGGG - Intronic
962037554 3:131668737-131668759 GTAGAGGAAAGGCCAGAGCATGG + Intronic
969715567 4:8866600-8866622 GAAGACCCAAGGCAAGAGCACGG + Intronic
970996825 4:22277244-22277266 GAAAAGCCAAGGAAAGAGCCTGG + Intergenic
972008427 4:34141794-34141816 GAATTGACAAGGTAAGAGCAAGG - Intergenic
976762322 4:88562959-88562981 GAATAGCCAAAGCCATCCCAAGG - Intronic
977158400 4:93603328-93603350 CAAAAGCCTAAGCCAGAGCAAGG + Intronic
977882430 4:102220409-102220431 GAATAGACAAGGACAGAGAAAGG + Intergenic
980157957 4:129129660-129129682 GAATAGCCTGGCTCAGAGCAGGG + Intergenic
982803690 4:159735994-159736016 GAATAGCCCAGACCAGTGCGGGG - Intergenic
988967655 5:36436425-36436447 GAATAGCCAAGACGATTGCAAGG - Intergenic
989774623 5:45189121-45189143 GAATTGCAGAGGCCATAGCAGGG + Intergenic
991100802 5:62790550-62790572 AGATAGCCAAGGGCAGAACACGG + Intergenic
991561500 5:67958313-67958335 GAAGAGGCAAGTCCTGAGCAAGG + Intergenic
997540510 5:134657814-134657836 GAAAAGCCAAGGTGGGAGCACGG - Intronic
997717009 5:136049881-136049903 GAATAGCCAAGGCCAGAGCAAGG + Intronic
998300349 5:141012750-141012772 GGAAGGCCAAGGCCAGAGGATGG + Intergenic
999287289 5:150401821-150401843 GAAAAGCCAAGGCCAAAGGCTGG + Intronic
1001174232 5:169450478-169450500 GAAAAGCCATGGACAAAGCAGGG + Intergenic
1002540328 5:179902491-179902513 GCACAGCCAGGGCCAGTGCAGGG + Intronic
1002559356 5:180071360-180071382 GGAGAGCCAGGGCCAGAGCCGGG + Intronic
1004014709 6:11721304-11721326 GAAGAGCAAAAGCCAAAGCAGGG + Intronic
1004784739 6:18955098-18955120 AAATAGGCAATGCCAGATCAAGG - Intergenic
1007704999 6:43785177-43785199 GAATGTGCAAGGCCAGGGCATGG + Exonic
1007949457 6:45858530-45858552 GAATAGCCATGCCCAGCCCAGGG - Intergenic
1008102994 6:47412810-47412832 GAGAAGCCAAGGCAAGAGGATGG + Intergenic
1008168802 6:48176346-48176368 GCAAAGGCAAGGGCAGAGCAGGG - Intergenic
1016666025 6:146641431-146641453 GAATAGCCAAGGCAATCCCACGG + Intronic
1016938186 6:149464059-149464081 CAATAGCTGAGGCCACAGCATGG + Intronic
1017823398 6:158064690-158064712 GAATGGCCACAGCCTGAGCAAGG + Exonic
1018008767 6:159648671-159648693 GAAGAGCCAGGATCAGAGCAGGG + Intergenic
1022236500 7:28466962-28466984 GACTAGCCACAGCCACAGCAGGG + Intronic
1022305797 7:29145779-29145801 CACTAGCCAAGGCCAGAACTGGG + Intronic
1022495387 7:30850047-30850069 GCATGGCCAGGGCCAGGGCAGGG + Intronic
1022652207 7:32287680-32287702 GAAAAGCAAAGGCCAGGTCATGG + Intronic
1026512024 7:71035334-71035356 GAATAGCCAAGGCTAAGGCAAGG + Intergenic
1026512289 7:71037545-71037567 GGCTGGCCAAGGCCAGAGCTTGG + Intergenic
1028152060 7:87385151-87385173 GAATAGCCAATGCAATACCAGGG - Intronic
1029111405 7:98214616-98214638 GCTGAGCCATGGCCAGAGCAGGG + Exonic
1030711916 7:112759393-112759415 GAATAACCAAGGCCTGAGGATGG + Intergenic
1031730922 7:125299561-125299583 GGCTGGCCAAGGCCAGAGCCTGG - Intergenic
1032690183 7:134277663-134277685 GGACAGCCAAGGGCAGACCAAGG - Intergenic
1032813308 7:135444711-135444733 GAATAGCCCATCGCAGAGCAAGG - Intronic
1035556978 8:574638-574660 GCAGAGGCAGGGCCAGAGCAAGG + Intergenic
1039076768 8:33697424-33697446 CCAAAGCCAAGTCCAGAGCAAGG - Intergenic
1040594479 8:48824217-48824239 GAATAGAGAAGGCAAGAGAAGGG - Intergenic
1040944863 8:52873957-52873979 CAATAGCCAAGGGCTGGGCACGG - Intergenic
1042100760 8:65272742-65272764 GAAGAGCCAAGGCCACAGAACGG + Intergenic
1042347386 8:67741336-67741358 GAATTGGCAAGGACATAGCAAGG + Intronic
1043565197 8:81540009-81540031 GAATTGCCAAGGACAAAGCCTGG + Intergenic
1044478072 8:92651824-92651846 GAATAGTCAAGACCAGAACAAGG - Intergenic
1046347340 8:112949012-112949034 GGATGGCCAAGGCAAGAGGATGG - Intronic
1047164050 8:122416830-122416852 GAATTGTAATGGCCAGAGCATGG - Intergenic
1049238108 8:141522845-141522867 GAGTTGCCAAGGGCACAGCAAGG + Intergenic
1049599224 8:143499307-143499329 CAACACCCAGGGCCAGAGCATGG + Intronic
1050699493 9:8322503-8322525 TCAAAGCCTAGGCCAGAGCAAGG + Intronic
1050740349 9:8812673-8812695 AATTAGCCAATGCCATAGCAAGG + Intronic
1051353010 9:16215941-16215963 GCAGAGCCGAGTCCAGAGCAGGG + Intronic
1052109182 9:24559541-24559563 CAGTAGTCAAGGCCAGAGAATGG + Intergenic
1053483102 9:38430844-38430866 CAACTGCCAAGGGCAGAGCAGGG + Intergenic
1053692394 9:40592939-40592961 GCAAAGCCAAGGCCAGGGCAGGG - Intergenic
1053692573 9:40593567-40593589 GAAGAACCAGGGCCAGGGCAGGG - Intergenic
1054272244 9:63043966-63043988 GAAGAACCAGGGCCAGGGCAGGG + Intergenic
1054272422 9:63044594-63044616 GCAAAGCCAAGGCCAGGGCAGGG + Intergenic
1054303636 9:63393857-63393879 GCAAAGCCAAGGCCAGGGCAGGG - Intergenic
1054303815 9:63394485-63394507 GAAGAACCAGGGCCAGGGCAGGG - Intergenic
1054402414 9:64720367-64720389 GCAAAGCCAAGGCCAGGGCAGGG - Intergenic
1054402593 9:64720995-64721017 GAAGAACCAGGGCCAGGGCAGGG - Intergenic
1054436024 9:65204698-65204720 GCAAAGCCAAGGCCAGGGCAGGG - Intergenic
1054436204 9:65205326-65205348 GAAGAACCAGGGCCAGGGCAGGG - Intergenic
1054486976 9:65735837-65735859 GAAGAGCCAGAGCCAGAGCCAGG + Intergenic
1054494188 9:65816361-65816383 GAAGAACCAGGGCCAGGGCAGGG + Intergenic
1054494368 9:65816989-65817011 GCAAAGCCAAGGCCAGGGCAGGG + Intergenic
1059277356 9:113107904-113107926 GAAGAGCCATGGCCAAAGCAGGG + Intergenic
1059278895 9:113116647-113116669 GAAGAGCCATGGCCAAAGCAGGG - Intergenic
1059383101 9:113943779-113943801 GCACAGCCGAGGCCAGGGCAGGG - Intronic
1062635032 9:137486164-137486186 GATTGGCCAAGGTCAGAGTAAGG + Intronic
1203623045 Un_KI270749v1:139044-139066 GCAAAGCCAAGGCCAGTGCAGGG - Intergenic
1186608806 X:11118824-11118846 GGGTAGCCAAGGACAGGGCAAGG + Intronic
1188438690 X:30192921-30192943 TGATAGCAAAGGCCAGACCAAGG + Intergenic
1188497329 X:30794140-30794162 GACAAGGCAAGGCCAAAGCAAGG - Intergenic
1190243849 X:48677578-48677600 GAAGCGCCAGGGCCAGGGCAAGG + Intronic
1195252839 X:103064488-103064510 AAAAGGCCAAGGCCAGAGGAAGG - Intergenic
1195447651 X:104972243-104972265 AAGTTCCCAAGGCCAGAGCAAGG - Intronic
1195587784 X:106585650-106585672 GAGTAGCCAAGGACAGAGGCTGG + Intergenic
1195698392 X:107683666-107683688 GACCTGCCAAGGCCATAGCAAGG + Intergenic
1196287604 X:113900271-113900293 AAATATCCAAGGCCAGTGAATGG - Intergenic
1196324859 X:114390712-114390734 GAATAACCAGAACCAGAGCATGG + Intergenic
1199903406 X:152200013-152200035 GAGGAGTCAAGGACAGAGCAAGG - Intronic
1201190979 Y:11441408-11441430 GCAAAGCCAAGGCCAGGGCAGGG - Intergenic
1201321004 Y:12698570-12698592 GAATACCCTAGGATAGAGCACGG - Intergenic
1201343740 Y:12960275-12960297 AAATTCCCAAGGCCACAGCAAGG + Intergenic