ID: 997717571

View in Genome Browser
Species Human (GRCh38)
Location 5:136053389-136053411
Sequence CTGCTGTGCATGGGCAAAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 354
Summary {0: 1, 1: 0, 2: 4, 3: 24, 4: 325}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997717566_997717571 -6 Left 997717566 5:136053372-136053394 CCTTTCAGAAGATCTGCCTGCTG 0: 1
1: 0
2: 1
3: 15
4: 193
Right 997717571 5:136053389-136053411 CTGCTGTGCATGGGCAAAGAGGG 0: 1
1: 0
2: 4
3: 24
4: 325

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997717571 Original CRISPR CTGCTGTGCATGGGCAAAGA GGG Intronic
900337815 1:2173402-2173424 CTGCTGTCCTTGGGCAAAACGGG + Intronic
900605032 1:3520042-3520064 CTGATGGGCATGGGCCGAGAAGG + Intronic
902490284 1:16776318-16776340 CTCCTGTGCCTTGGCATAGAGGG + Intronic
902614171 1:17614824-17614846 GTGCTGTGCATGGGGAAGCAGGG - Intronic
903377173 1:22874252-22874274 CCTCTGTGAATGGGCAAGGAAGG - Intronic
903597827 1:24509510-24509532 TTCCTGTGAATGAGCAAAGAGGG - Intronic
904042670 1:27593441-27593463 CTGGTGTCCATGGGCAAAGATGG + Intronic
904266659 1:29322243-29322265 GAGCTGTTCATGGGCAAAGTTGG - Intronic
905567622 1:38978377-38978399 CTGCTGGATAGGGGCAAAGAAGG + Intergenic
905742886 1:40387960-40387982 CTGCTGGCCCTGGGCAATGAGGG + Intronic
907523226 1:55038693-55038715 CTGCTGTGCATCTGCAAGGGAGG + Intergenic
909904572 1:81178860-81178882 CTGCTGGCCCTGGGCAATGAGGG - Intergenic
910070335 1:83206364-83206386 TAGCTGTGCATTGGCAAAGAAGG - Intergenic
910687881 1:89936923-89936945 TTGCTGATAATGGGCAAAGATGG + Intergenic
912165838 1:107041001-107041023 GTGATGTGCATGGGGTAAGAAGG - Intergenic
913190125 1:116406408-116406430 CTGCTCTTCATGGGTAAAGCTGG + Intronic
913383304 1:118232783-118232805 CTGCTGGATAGGGGCAAAGAAGG - Intergenic
913447432 1:118964706-118964728 AGGCTGTGCATGGTGAAAGAAGG + Intronic
913470102 1:119178794-119178816 CTGCTGGATAGGGGCAAAGAAGG - Intergenic
914213514 1:145603590-145603612 CTGCTCTGCCTGAGCACAGACGG + Intergenic
914339406 1:146746213-146746235 CTGCTGTCCATGGGCAGGGGAGG - Intergenic
915619809 1:157074250-157074272 CTGCTGTGCATCTGCAATGGCGG - Intergenic
916910117 1:169337330-169337352 CTGCTGGCCCTGGGCAATGAGGG - Intronic
916921135 1:169468171-169468193 CTGCAGTGCCAGGGCAATGAAGG + Exonic
917280616 1:173375333-173375355 CTGCTGGATAGGGGCAAAGAGGG - Intergenic
917465921 1:175276059-175276081 CTATAGTGCATGGGGAAAGAGGG - Intergenic
919985525 1:202671355-202671377 CAACTGTGCATGGGCCAAGGCGG + Intronic
921897092 1:220412539-220412561 CTGCTGGCCCTGGGCAATGAGGG + Intergenic
922493265 1:226035866-226035888 CTGCTGCCCACAGGCAAAGAGGG - Intergenic
922701181 1:227762056-227762078 CAGCTGTGCAAGTGAAAAGACGG - Intronic
923530156 1:234806212-234806234 CTCCTGTGCCTTGGCATAGAGGG - Intergenic
1062937636 10:1400118-1400140 CCGCTGAGCGTGGGCAGAGAGGG + Intronic
1063300399 10:4845168-4845190 CTGCTGGCCCTGGGCAATGAGGG - Intronic
1063415298 10:5868318-5868340 CTGCTGGATAGGGGCAAAGAAGG - Intronic
1064197679 10:13259328-13259350 CTGCTGGATAGGGGCAAAGAAGG - Intergenic
1068281469 10:54876301-54876323 CTGATGTGGATGTACAAAGAAGG + Intronic
1068902108 10:62280485-62280507 CTGCTGGCCCCGGGCAAAGAGGG + Intergenic
1069364640 10:67684583-67684605 CTGCTGGATAGGGGCAAAGAAGG + Intronic
1069777396 10:70934984-70935006 TTACTGTGCCTGGGCAAGGAAGG + Intergenic
1070452345 10:76573954-76573976 TTGCTGAGCATGAGAAAAGATGG - Intergenic
1072995138 10:100236898-100236920 CTCCTGTGCCTGGGTAATGAAGG + Exonic
1073458007 10:103649286-103649308 ATGCTGTGGATGAGCAAAGCCGG + Intronic
1073568058 10:104552546-104552568 GTGCAGTGCATGGGCCATGAAGG + Intergenic
1075871649 10:125775544-125775566 CGGCTGTGCAGAGGCAGAGAAGG - Intronic
1076062389 10:127423538-127423560 CAGCTGTGTATGGAGAAAGATGG - Intronic
1076885197 10:133258943-133258965 CTGCAGTGCATAGGCTGAGAGGG - Intergenic
1077192997 11:1263288-1263310 CTGCTGGGCCTCGGCAAGGAGGG - Intergenic
1077956235 11:7022332-7022354 CTGCCTTGCATGGGAAGAGAGGG + Intronic
1078428387 11:11269185-11269207 CTGCCCTGCATGGGCTAAGCAGG + Intergenic
1079639034 11:22781147-22781169 CTGCTGTCCTTTGGCAAACAAGG + Intronic
1079811065 11:25000355-25000377 CTGCTGGATAGGGGCAAAGAAGG + Intronic
1079968411 11:27006613-27006635 CTCCTGTCCATCTGCAAAGATGG - Intergenic
1081421975 11:42881110-42881132 CTGCTGGATAGGGGCAAAGAAGG - Intergenic
1083924388 11:65797251-65797273 CTTCTCTGCATGGGGAAAAAGGG - Intergenic
1084183459 11:67457905-67457927 AAGGTGTGCATGGGCAGAGATGG + Intronic
1085158780 11:74321871-74321893 CTGCTGTGCTTGGCCCCAGAGGG + Intergenic
1087008810 11:93494517-93494539 CTGCTGAGCATGGACACAGGCGG - Intronic
1090108916 11:123883864-123883886 CTGCTGTGCCTGGCCTCAGAGGG - Intronic
1090307690 11:125704955-125704977 CTGCTGGCCCTGGGCAATGAGGG - Intergenic
1090575871 11:128102919-128102941 CAGCTGTGCAGGTGCAGAGAAGG + Intergenic
1090649230 11:128791834-128791856 CTGCGGTGGTTGGGCCAAGAAGG - Intronic
1091899284 12:4131737-4131759 CTTCTGTGAAAGGGCAAATATGG - Intergenic
1093346177 12:18039981-18040003 CTGCTGGATAGGGGCAAAGAAGG - Intergenic
1098230905 12:68370881-68370903 CTGCTGTGCCTGGGCACTGCAGG - Intergenic
1099797881 12:87421621-87421643 CTGCTGGAGAGGGGCAAAGAAGG + Intergenic
1100050530 12:90443862-90443884 CTGCTGGATAGGGGCAAAGAAGG + Intergenic
1100529296 12:95449243-95449265 CTGCTGGATAGGGGCAAAGAAGG + Intergenic
1101318688 12:103653502-103653524 CTGCAGTGCATGTGTGAAGATGG + Intronic
1102551774 12:113696576-113696598 CTGCTGGCTATGGCCAAAGATGG + Intergenic
1102979694 12:117231649-117231671 CTCCTAAGCATGGGCTAAGATGG + Intronic
1103003769 12:117406013-117406035 CTGCTCTGCATGGGCCAGGCTGG - Intronic
1103842914 12:123879839-123879861 CTCCTGAGCATGGGCCAAGCGGG + Intronic
1104767961 12:131342600-131342622 CTGCTGGATAGGGGCAAAGAAGG + Intergenic
1106488674 13:30195513-30195535 CTGCTGTGAGTGGGTGAAGAAGG - Intergenic
1108181266 13:47842055-47842077 CTCCTGTGCATGGGCCAAGAGGG + Intergenic
1108858967 13:54829753-54829775 CTGCTGGCCCTGGGCAATGAGGG - Intergenic
1110046820 13:70842131-70842153 CTGCTGCCCGTGGGCCAAGAAGG + Intergenic
1111591016 13:90348706-90348728 CTGCTGGCCCTGGGCAATGAGGG + Intergenic
1112076769 13:95922532-95922554 CCACTGTGCCTGGCCAAAGATGG - Intronic
1113159316 13:107362067-107362089 CTGCAGTGCATAGGTAGAGATGG + Intronic
1114593527 14:23891864-23891886 CTGCTGGCCCTGGGCAATGAGGG + Intergenic
1114955711 14:27815918-27815940 CTGCTGTGCATCTGCAGTGAAGG - Intergenic
1115197008 14:30812304-30812326 CTGCTGCGCATGTGTAAAAAAGG + Intergenic
1115284999 14:31706220-31706242 CTGCTGGATAGGGGCAAAGAAGG + Intronic
1121610339 14:95274387-95274409 CTGCTGTGCATGGGCAGGGGTGG - Intronic
1121950470 14:98167070-98167092 TTGCTGACCATGAGCAAAGAGGG + Intergenic
1122027127 14:98886188-98886210 CTGCAGTGCATGGGCAGAGCAGG - Intergenic
1122532248 14:102436605-102436627 CTGCTGTGCCTGGCCAAGGGTGG + Intronic
1122634193 14:103122654-103122676 CTGCGCTGAATGGGCAAAGCCGG + Intergenic
1123701808 15:22919733-22919755 CCACTGTGCCTGGCCAAAGAAGG - Intronic
1124211332 15:27767302-27767324 CTGCTGGATAGGGGCAAAGAAGG - Intronic
1124415176 15:29467735-29467757 CTTCTGTGCCTGGCCATAGATGG - Intronic
1125590987 15:40854307-40854329 GTGCTGTGTCTGGGCAGAGAGGG + Intronic
1126070614 15:44862139-44862161 CTGCTGGATAGGGGCAAAGAAGG + Intergenic
1126639665 15:50812076-50812098 CTGCAGTCCCTGGGCAATGAGGG + Intergenic
1126729854 15:51671618-51671640 CTGCTGTGACTGGGCATAGGGGG + Intergenic
1127835672 15:62789084-62789106 CTGATGTTCATGGGCCAGGAGGG - Intronic
1127939308 15:63677893-63677915 CTGCTGGGAGTGGTCAAAGAGGG - Exonic
1129859159 15:78846981-78847003 CTGCTGGTCCTGGGCAATGAGGG + Intronic
1131411889 15:92214280-92214302 CTGCTGGATAGGGGCAAAGAAGG - Intergenic
1133702921 16:8325995-8326017 ATGCTGAGCACTGGCAAAGAGGG - Intergenic
1134268958 16:12717034-12717056 CTGCTGAACAGGGGGAAAGAAGG + Intronic
1134681209 16:16127042-16127064 CTGCTGTTCAGGGCCTAAGAAGG - Intronic
1135748934 16:25040799-25040821 CTGCTTTTCATGCCCAAAGAAGG + Intergenic
1137607578 16:49796803-49796825 CTGCTGTGCACAGGCACAAAAGG + Intronic
1137861475 16:51850919-51850941 CTGTTGTGCATAGGCACAGAGGG - Intergenic
1139397505 16:66652032-66652054 CTGCTCTGGAAGGGCAGAGATGG + Intronic
1139649065 16:68353013-68353035 CTGGTTTTCATGGCCAAAGAGGG + Intronic
1139994869 16:70971134-70971156 CTGCTGTCCATGGGCAGGGGAGG + Intronic
1141252399 16:82370285-82370307 CTGCTGTGCCTGGGAACAGTTGG - Intergenic
1141441772 16:84033870-84033892 CTGCTGTGCATGAGCATTGTAGG + Intronic
1141799083 16:86295085-86295107 CTGCTGTGCAGGGGTATGGACGG + Intergenic
1141916144 16:87098653-87098675 CCGCTTTGCATGGGCAGGGAGGG + Intronic
1141942144 16:87284108-87284130 CTGCTTTGTATGGCCAATGAGGG - Intronic
1142498986 17:321808-321830 CTCCTGGGCCTTGGCAAAGACGG + Intronic
1143731224 17:8884110-8884132 GTGCTGGGCAGGGGAAAAGAGGG - Intronic
1145124579 17:20289591-20289613 CTACTGTGCCTGGCCAAAAAGGG + Intronic
1146320620 17:31843724-31843746 CTTGTGTGCCTGGGCTAAGACGG - Intergenic
1146565900 17:33912557-33912579 CTGCTGTCAAGGGGAAAAGATGG - Intronic
1146951553 17:36910156-36910178 CAGGGGGGCATGGGCAAAGAAGG + Intergenic
1147133022 17:38419912-38419934 CTGCTGTGACTGGGAAAGGAGGG - Intergenic
1149213928 17:54332311-54332333 CTGCTGGATAGGGGCAAAGAAGG - Intergenic
1149329720 17:55568243-55568265 CAGCTATGCAAAGGCAAAGATGG + Intergenic
1151344575 17:73493799-73493821 GAGCTGTGCATGGGCACACAGGG + Intronic
1151425283 17:74027121-74027143 CTGCTGTACATAGGTAAACATGG + Intergenic
1151477033 17:74350084-74350106 CTACTGTGCCTGGCCACAGACGG + Intronic
1152347150 17:79760204-79760226 CAGCTTTGCATTGACAAAGACGG + Intergenic
1152739440 17:82012564-82012586 CTGCTGTGCTGGGGCCAAGGCGG + Intronic
1155204189 18:23543398-23543420 CTGCTGAGCCTGGAGAAAGAAGG - Intronic
1156289224 18:35730996-35731018 CTCCTGTCCATCTGCAAAGACGG + Intergenic
1156455360 18:37290193-37290215 CTGCTGTGCATGGACAGGGAAGG - Intronic
1156770656 18:40718657-40718679 CTGCTGTGCTTGGATAGAGATGG + Intergenic
1156999930 18:43511723-43511745 CTGGTCTGCTTGGGAAAAGATGG + Intergenic
1157110412 18:44815402-44815424 CTACTTTTCAGGGGCAAAGAAGG + Intronic
1157244270 18:46039617-46039639 CTGCTGAGGATTGGCAAAGAAGG - Intronic
1157856998 18:51112438-51112460 CTGCTGGATAGGGGCAAAGAAGG + Intergenic
1158322880 18:56282596-56282618 CTGCTGGGAATAGGCAAAGCTGG + Intergenic
1158771705 18:60525658-60525680 CTGAAGTGCATGTCCAAAGAAGG - Intergenic
1159963920 18:74577914-74577936 CTGCAGATCTTGGGCAAAGAGGG + Intronic
1160041005 18:75345408-75345430 CTGTCGTGCATGAGCAAAAATGG - Intergenic
1160112783 18:76049178-76049200 CCGCTGAGCATGGGAAGAGAAGG - Intergenic
1160423695 18:78766598-78766620 GTGCAGTGCATGGGGCAAGAGGG + Intergenic
1160434560 18:78836427-78836449 CAGCTGTGCCTGGGGACAGAAGG - Intergenic
1160914417 19:1489974-1489996 CTGCTGGGGAAGGACAAAGAAGG - Intronic
1161124450 19:2547873-2547895 CTGCTGTGCATGGGCACACGTGG + Intronic
1162632710 19:11941548-11941570 CTGCTGGCCCTGGGCAATGAGGG - Intronic
1163554819 19:17985864-17985886 CTGCTTTGCAAGGGCTAAGTCGG + Intronic
1164992430 19:32693922-32693944 CTGCTGGACAGGGGCAAAGAAGG + Intronic
1165775974 19:38404493-38404515 CCACTGTGCCTGGGCAAAGGTGG + Intronic
1166927523 19:46279121-46279143 TGGCTGTGTAGGGGCAAAGAGGG - Intergenic
1167958975 19:53090784-53090806 CTGCTGTGCAGACGCAATGAAGG + Intronic
926102592 2:10128571-10128593 CTGCTGTGTGTTGGCAAAGGAGG - Intronic
926321721 2:11753077-11753099 CTCCTGTCCCTGGGCAAGGAGGG + Intronic
928701642 2:33904145-33904167 CTGCTGGATAGGGGCAAAGAAGG + Intergenic
929912867 2:46106649-46106671 CAGGTGTGCATGTGCACAGAGGG - Intronic
930219774 2:48734750-48734772 CTGCTGTCCAGGGTCAAAAAAGG + Intronic
931043552 2:58325258-58325280 GAGCTGTGAATGGGAAAAGAGGG + Intergenic
931599646 2:63990527-63990549 CTGGTGTGCATGTGTGAAGAAGG - Intronic
932188100 2:69715742-69715764 CCTCTGTGCATAGGCACAGAAGG - Intronic
932568633 2:72924943-72924965 CTGCTGTTCCTGGGCAAAACTGG + Intronic
933938203 2:87224076-87224098 CTGCTGCTCATAGCCAAAGAGGG - Intergenic
934481566 2:94652143-94652165 CTGCTGTGCATCTGCAGTGAAGG + Intergenic
934689563 2:96347864-96347886 TTGCTGTGCACGGGCAGGGAGGG + Intronic
935248006 2:101236128-101236150 CTGCTGGATAGGGGCAAAGAAGG - Intronic
935684294 2:105669933-105669955 CTGCTGCTCCTGGGCAAAGCTGG + Intergenic
936354933 2:111741699-111741721 CTGCTGCTCATAGCCAAAGAGGG + Intergenic
936496503 2:113026489-113026511 CTGCTTGTCATGTGCAAAGAAGG + Intronic
937754761 2:125523694-125523716 CTTCTGTCCATGCCCAAAGACGG + Intergenic
937964025 2:127487489-127487511 CTGCTGGGGATGGGGAGAGAAGG + Intronic
938238212 2:129723345-129723367 CTGCTGTGAAAGGGCCAAGCTGG - Intergenic
938726038 2:134109598-134109620 CTGCTGGCCCTGGGCAATGAGGG - Intergenic
939777364 2:146403944-146403966 CTGCTGGCCCTGGGCAATGAGGG - Intergenic
941243849 2:163072639-163072661 CTGCTGGATAGGGGCAAAGAAGG - Intergenic
941853349 2:170206293-170206315 CTGCTGAGGGAGGGCAAAGAGGG - Intronic
942611169 2:177744019-177744041 CTGCTGGGCAGGGGCAGAGGAGG - Intronic
943548804 2:189312741-189312763 AGGCTGTGAATGAGCAAAGATGG - Intergenic
943764751 2:191648568-191648590 CTACTGTGCTTGGCCAAAGTTGG + Intergenic
944729537 2:202503113-202503135 CTGCTGGATAGGGGCAAAGAAGG - Intronic
946752429 2:222905778-222905800 CAGCTGTGCATGAGCAAATTTGG + Intronic
947908685 2:233786387-233786409 CTCCTGTGCATGCGCACAGTGGG + Intronic
948857194 2:240735644-240735666 CTGCTGTGCCTGGGCCATGGGGG - Intronic
1171134734 20:22686194-22686216 CTGCAGCGCATGGGCACAGCTGG - Intergenic
1171261958 20:23742015-23742037 CTGCTGGATAGGGGCAAAGAAGG - Intergenic
1171271062 20:23817745-23817767 CTGCTGGATAGGGGCAAAGAAGG - Intergenic
1171458214 20:25283607-25283629 CAGCTCTCCAGGGGCAAAGAGGG - Intronic
1172692195 20:36797571-36797593 CAGCTGGGCAAGGGCAGAGAGGG + Exonic
1172929945 20:38579445-38579467 CTGTTGTGCGTGGGCAGAGCAGG - Intergenic
1173029317 20:39340191-39340213 CTGCAGTGCATGTGCAATGCTGG + Intergenic
1173478987 20:43384393-43384415 CTGGTGAGCATGGGGACAGACGG - Intergenic
1175236580 20:57517197-57517219 GTGGTGTGAATGAGCAAAGAAGG + Intronic
1175254144 20:57628902-57628924 CTGCTGGCCCTGGGCAATGAGGG + Intergenic
1175924354 20:62464748-62464770 CTGCTGTGCTGGAGCAAAGCAGG + Exonic
1176690988 21:9908381-9908403 CTGGTGGGCATGTGTAAAGAGGG - Intergenic
1177203067 21:17978923-17978945 CTCATGTGCATGGACAGAGAGGG - Intronic
1179907570 21:44431997-44432019 CTGTTGTGAATGGGCCAAGAGGG - Intronic
1181064910 22:20300923-20300945 CTGCTGTGCTTGTGCACACAAGG + Intergenic
1181111241 22:20604234-20604256 ATGCTGACCATGGGCAAAGGGGG + Intergenic
1181869990 22:25890680-25890702 ATCCTGTGCATGGGGAGAGAAGG + Intronic
1182994126 22:34797336-34797358 CTGCTCTGGAAGGGCAGAGAAGG + Intergenic
1183066397 22:35366430-35366452 CTGCTGACCATGGGCAATGTGGG + Intergenic
1183807618 22:40224882-40224904 CTACTCTGCATCAGCAAAGAAGG - Intronic
1184073746 22:42163116-42163138 CTGCTGTGTATTGGTAAAGAGGG - Intronic
1184641861 22:45877124-45877146 GGGCTTTGCATGGGCAAAGTGGG - Intergenic
949172930 3:1023890-1023912 CAGCTGTGAACGTGCAAAGAGGG - Intergenic
950837410 3:15934039-15934061 TTGCTTTGCATTGGAAAAGATGG - Intergenic
951021097 3:17781562-17781584 CTGCTGGATAGGGGCAAAGAAGG - Intronic
952147244 3:30547150-30547172 CTGCAGTGCCTTGGCCAAGAGGG - Intergenic
953462789 3:43095051-43095073 CTGCTGAGCAGGGGCAAGGAAGG - Intronic
954686527 3:52373094-52373116 GTGCTGTGCAGGGGCACAGGAGG + Intronic
954847855 3:53575332-53575354 CTGCCGTGCATGGGCAGGAAGGG + Intronic
955186322 3:56718661-56718683 CTGCTGGACAGGGGCAAAGAAGG - Intergenic
958733142 3:97979768-97979790 CTGCTGTGCCTGGCCAGGGATGG + Intergenic
961374477 3:126454712-126454734 CTGCTGTCTAAGGGCAGAGAAGG - Intronic
961460455 3:127046785-127046807 CTGCTGGCCCTGGGCAATGAGGG + Intergenic
963021709 3:140878280-140878302 CTGCTGGATAGGGGCAAAGAAGG - Intergenic
964470514 3:157048799-157048821 CTGGTATTCATGGACAAAGATGG + Intergenic
965139779 3:164818211-164818233 CTGCTGGATAGGGGCAAAGAAGG - Intergenic
965471131 3:169093689-169093711 TTGCAGTGCATAGGCAAGGAAGG - Intronic
968473294 4:791640-791662 CTGCCCTGGATGGGCCAAGATGG - Intronic
968635761 4:1678082-1678104 CCGCTGTGCCTGGGCACACACGG - Intronic
969156003 4:5210412-5210434 ATGCTGTGAATGTGCAGAGATGG - Intronic
969233021 4:5845036-5845058 GTGCTATGCCTGGCCAAAGATGG + Intronic
969293059 4:6252872-6252894 TTGGTGTGCATGGCCAAGGAGGG - Intergenic
969464044 4:7344271-7344293 CTGCTCAGCATCTGCAAAGAAGG - Intronic
969470932 4:7388942-7388964 GTGCTGTGCATGGGAAATGAGGG - Intronic
972132842 4:35859527-35859549 CTGCTGGATAGGGGCAAAGAAGG + Intergenic
975004882 4:69271874-69271896 CTGCTGGTTAGGGGCAAAGAAGG - Intergenic
975013305 4:69380854-69380876 CTGCTGGTTAGGGGCAAAGAAGG - Intronic
976174026 4:82334393-82334415 CTGCTGGATAGGGGCAAAGAAGG + Intergenic
976461672 4:85319711-85319733 AGGCAGTGCATGGGCAAATATGG - Intergenic
976694557 4:87905113-87905135 CTTCTGTTCATAGGAAAAGAAGG + Intergenic
978339850 4:107710776-107710798 CTCCTGTCCATCTGCAAAGATGG + Intronic
979715540 4:123832766-123832788 CTGCTTTGTATGGGCACAGTGGG + Intergenic
980857653 4:138459173-138459195 CTGATATGTATGGGCAAAGAAGG - Intergenic
981007499 4:139890741-139890763 CTGTTCTGCAAGGGCAAAGAAGG + Exonic
983084648 4:163428027-163428049 CTGCTGGATAGGGGCAAAGAAGG - Intergenic
983272601 4:165580595-165580617 CTGCTGTGCATGTTGAAACAAGG + Intergenic
984725025 4:183012629-183012651 TTGCTGTGAGTGGGCAAGGATGG - Intergenic
984939028 4:184915555-184915577 CTGCTGGATAGGGGCAAAGAAGG + Intergenic
985841092 5:2306534-2306556 CTGGGGTGGCTGGGCAAAGAAGG - Intergenic
986033601 5:3916816-3916838 CTGCAGACCATGGGCAAAGTAGG + Intergenic
986332019 5:6724259-6724281 CCTCTGTGAATGGGCAGAGATGG + Intronic
986626159 5:9725426-9725448 CTGCTGGCCCTGGGCAATGAGGG + Intergenic
986865574 5:11982450-11982472 ATGCTCTGCATTGACAAAGATGG - Intergenic
987931159 5:24400581-24400603 CTGCTGGATAGGGGCAAAGAAGG - Intergenic
989437651 5:41433583-41433605 CTCCTGTGCCTGAGCAAACATGG - Intronic
989496696 5:42117143-42117165 CTGCTGGATAAGGGCAAAGAAGG - Intergenic
990186801 5:53218746-53218768 CTGCTGAGTAGGGGCATAGAAGG + Intergenic
990359927 5:55007804-55007826 CTGCTGTGAAACAGCAAAGATGG - Intronic
990687779 5:58326603-58326625 CTGATGTGTTTGGACAAAGATGG + Intergenic
991463373 5:66883179-66883201 CTGCTATGGATGGGGTAAGAAGG + Intronic
992455756 5:76914168-76914190 CTGCTGGATAAGGGCAAAGAAGG - Intronic
993328586 5:86569775-86569797 CTGCTGGCCCTGGGCAAAGAGGG - Intergenic
997335669 5:133107420-133107442 CTGCTTTGCAGGGGCACAGGGGG + Intergenic
997717571 5:136053389-136053411 CTGCTGTGCATGGGCAAAGAGGG + Intronic
998758158 5:145403440-145403462 CTACTGTGCATGGGGGAAGCAGG - Intergenic
1000066028 5:157693947-157693969 CTGCTGGCCCTGGGCAATGAGGG + Intergenic
1000085771 5:157886601-157886623 CTGCTGGATAGGGGCAAAGAAGG - Intergenic
1000188254 5:158881989-158882011 CTGCTTTGTATTTGCAAAGAAGG + Intronic
1001852895 5:174984936-174984958 GTGGTCTGCATGGGAAAAGAAGG + Intergenic
1001924852 5:175628525-175628547 CAGCAGTGCATGGGTAAGGAGGG + Intergenic
1004081175 6:12394570-12394592 TTGCTGTGCAGGGGCAGAGAGGG + Intergenic
1006175242 6:32117454-32117476 CTCCTGTGGGTGGGCAAGGAGGG - Intronic
1006222168 6:32500497-32500519 CTGCTGGATAGGGGCAAAGAAGG - Intergenic
1007309008 6:40930341-40930363 CAGCTGCACAAGGGCAAAGAGGG - Intergenic
1007944484 6:45813302-45813324 CTGCTGTGCATGGATTAATATGG + Intergenic
1009061359 6:58400960-58400982 CTGGTGTGCATGTGTGAAGAAGG - Intergenic
1009407109 6:63326705-63326727 CTGCTGGCCCTGGGCAATGAGGG - Intergenic
1009909307 6:69905477-69905499 CCGCTGTTCATCTGCAAAGATGG + Intronic
1012440976 6:99262061-99262083 CTGCTGGACAGGGGCAAAGAAGG + Intergenic
1013410785 6:109881394-109881416 CTGCTGGCCCTGGGCAATGAGGG - Intergenic
1013906963 6:115232388-115232410 CTGCTGGATAGGGGCAAAGAAGG + Intergenic
1016184596 6:141183253-141183275 CTGCTGGACAGGGGCAAAGAAGG - Intergenic
1019007839 6:168817229-168817251 CTGGTTTGCAAGGGCAAAGAAGG - Intergenic
1019747456 7:2708834-2708856 CACCTGTGCATGGGAATAGATGG + Intronic
1020042420 7:5014156-5014178 CCTCTGTGCATAGGCAAAGAAGG - Intronic
1021655463 7:22869707-22869729 CTGCTCTGCATGTGCCATGAGGG - Intergenic
1021758423 7:23878642-23878664 CTCATCTGCATGGTCAAAGATGG + Intergenic
1022750429 7:33219083-33219105 CTGCTGGCCCTGGGCAATGAGGG + Intronic
1023077648 7:36499762-36499784 CTGCTGGATAGGGGCAAAGAAGG + Intergenic
1024353586 7:48392784-48392806 CTGGGGTGCATGGGCCAGGAAGG + Intronic
1024648133 7:51385593-51385615 CTGCTGTGCTGGGGGAAAGCTGG + Intergenic
1024757298 7:52549952-52549974 CTGCTGTCCAGGGTCAAAGCTGG - Intergenic
1026185345 7:68078680-68078702 GTGCTGTGCATGCTCAGAGAAGG + Intergenic
1027288051 7:76671224-76671246 CAGCTGTGCATTGGCAAAGAAGG - Intergenic
1027665885 7:81042817-81042839 CTGCTGGCCCTGGGCAATGAGGG + Intergenic
1027791915 7:82645241-82645263 CTGCTGGATAGGGGCAAAGAAGG - Intergenic
1028576760 7:92360716-92360738 TTGGTGTGGATGTGCAAAGATGG - Intronic
1029274186 7:99394355-99394377 CTGCTGTGCTGGGGCTGAGATGG + Intronic
1030928053 7:115481928-115481950 CTGCTATGGATGGGTAAAGGGGG - Intergenic
1032554717 7:132819908-132819930 CTGAAGTGCATGAGAAAAGATGG + Intronic
1033758695 7:144418530-144418552 CTGCTGGATAGGGGCAAAGAAGG + Intergenic
1034821234 7:154218115-154218137 CAGCTGTGCATGTGCTGAGATGG + Intronic
1034862779 7:154614070-154614092 CAGCTGTGGATGGGCAAGGTGGG - Intronic
1036430700 8:8687549-8687571 CTGCAGTGCAGGGACCAAGATGG + Intergenic
1037983518 8:23272225-23272247 CTGCTGGCCCTGGGCAATGAGGG + Intronic
1038401392 8:27287353-27287375 CTCCTGACCATGGGCACAGAAGG + Exonic
1038430065 8:27492945-27492967 CTGCTGGATAGGGGCAAAGAAGG + Intronic
1039284857 8:36028935-36028957 CTGCTGGCCCTGGGCAATGAGGG + Intergenic
1039692311 8:39876696-39876718 CTGCTGGATAGGGGCAAAGAAGG + Intergenic
1040528118 8:48242109-48242131 CTGCTGGATAGGGGCAAAGAAGG - Intergenic
1041034666 8:53776150-53776172 CTGCTGGCCCTGGGCAATGACGG - Intronic
1041658723 8:60379855-60379877 CTGTTTTGCATTGGTAAAGATGG - Intergenic
1042772522 8:72394831-72394853 CTGCTGGATAGGGGCAAAGAAGG - Intergenic
1043868545 8:85402983-85403005 GTGCTCTGCATGAGCCAAGAGGG + Intronic
1044456088 8:92394173-92394195 CTGCTGGATAGGGGCAAAGAAGG + Intergenic
1045287469 8:100804380-100804402 CAGCTGTGCATGGTGAGAGAAGG + Intergenic
1045928506 8:107598167-107598189 CTGCTGGTTAGGGGCAAAGAAGG + Intergenic
1046133432 8:109996484-109996506 CTGCTTTGCAGGGGCAACTAAGG - Intergenic
1047346790 8:124036826-124036848 CTGCTGTGCACTGGCATTGATGG + Intronic
1047808480 8:128382330-128382352 CTGCTGGATAGGGGCAAAGAAGG - Intergenic
1047958354 8:129993014-129993036 CTACTGTGGATGGGCAAGGCTGG + Intronic
1048871719 8:138804429-138804451 CTGCTGTGCTTGAGCAGAGCAGG - Intronic
1049234572 8:141506093-141506115 CTGCTGTGCCTGGGGGAAGCCGG - Intergenic
1049647173 8:143740665-143740687 CTGCTGGGCATGGGCCATGCTGG + Intergenic
1049802639 8:144525290-144525312 CTGCTGGGCATGGGTGGAGAAGG - Intronic
1051295263 9:15588472-15588494 CTTCTTTGCAGGGGCAAAGAAGG - Intronic
1051329861 9:16012828-16012850 TTGCTGTGCATGGGTGGAGAGGG + Intronic
1052160131 9:25247382-25247404 CTGCTGGATAGGGGCAAAGAAGG - Intergenic
1052793559 9:32901565-32901587 TTCCTGTGCATGGGATAAGAAGG + Intergenic
1052856692 9:33411311-33411333 CTGCTGTGCAGGGGCAGTCATGG + Intergenic
1053133775 9:35636580-35636602 CTGCAGAGCAGGGCCAAAGATGG + Intronic
1053627728 9:39892911-39892933 CTGGTGGGCATGCGTAAAGAGGG - Intergenic
1053676266 9:40431961-40431983 CTGCTGTGCATCTGCAGTGAAGG - Intergenic
1053778268 9:41573119-41573141 CTGGTGGGCATGCGTAAAGAGGG + Intergenic
1054216160 9:62357798-62357820 CTGGTGGGCATGCGTAAAGAGGG + Intergenic
1054287453 9:63192932-63192954 CTGCTGTGCATCTGCAGTGAAGG + Intergenic
1054289334 9:63267486-63267508 CTGCTGTGCATCTGCAGTGAAGG - Intergenic
1054508355 9:65944333-65944355 CTGCTGTGCATCTGCAGTGAAGG + Intergenic
1054671321 9:67797552-67797574 CTGGTGGGCATGCGTAAAGAGGG - Intergenic
1054811842 9:69441326-69441348 CATCTGTGCGTGGGCTAAGAGGG - Intronic
1056080972 9:83093549-83093571 CTGCTGGCCCTGGGCAATGAGGG - Intergenic
1057664987 9:97038457-97038479 CTGCTGTGTATCAGCCAAGAAGG - Intronic
1058169500 9:101663210-101663232 CTGATCTGAATGGGGAAAGAAGG - Intronic
1058818740 9:108709666-108709688 CTGATCTTCATGGGCCAAGATGG - Intergenic
1059322388 9:113479806-113479828 CTGCTCTGCTGGGGCCAAGAAGG - Intronic
1059454454 9:114390725-114390747 ATGCTGAGCAAGGGCAGAGAGGG - Intronic
1185734910 X:2489188-2489210 CTGCTGGACAAGGTCAAAGACGG - Exonic
1188842303 X:35031089-35031111 CTTCAGTGGATGGGCATAGATGG - Intergenic
1189264194 X:39701198-39701220 TTCCTGTGCTTGGGCAAAGGTGG - Intergenic
1192174305 X:68876202-68876224 CTCCTGTGCATGTGCAATGATGG - Intergenic
1192869768 X:75174231-75174253 CTGCTGGGTAGGGGCAAAGAAGG + Intergenic
1193967593 X:88007547-88007569 TTGCAGTGAATGGGGAAAGAAGG - Intergenic
1195440864 X:104896404-104896426 CTGCTGGATAGGGGCAAAGAAGG - Intronic
1197344839 X:125319315-125319337 CTGCTGGCCCTGGGCAATGAGGG - Intergenic
1197656026 X:129116809-129116831 CTGCTGTGAAAGGGCTCAGAGGG - Intergenic
1197698649 X:129578693-129578715 TTTCTGTTCATGGGCAAACATGG - Intronic
1198555488 X:137788887-137788909 CTCCTGTGCATGGACAAAGAAGG - Intergenic
1199868459 X:151875323-151875345 CTGCTGTTCTTGGGCAAGCAAGG - Intergenic
1199971041 X:152861389-152861411 CTTCTCTGCATGGGCAGACAGGG - Intronic
1200277619 X:154749757-154749779 CCGATGTGAATGGGGAAAGAGGG + Intronic
1201650248 Y:16276869-16276891 CTGCTGGACAGGGGCAGAGAAGG - Intergenic
1201743587 Y:17348156-17348178 CTGCTGGACAGGAGCAAAGAAGG + Intergenic
1201919809 Y:19222163-19222185 CTGCTGGATAGGGGCAAAGAAGG - Intergenic