ID: 997717756

View in Genome Browser
Species Human (GRCh38)
Location 5:136054723-136054745
Sequence TTGTATGGGCATCAATTGGA GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 101
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 95}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997717756_997717764 16 Left 997717756 5:136054723-136054745 CCCTCCAATTGATGCCCATACAA 0: 1
1: 0
2: 0
3: 5
4: 95
Right 997717764 5:136054762-136054784 CCACATAATTAAAGACCAGCTGG 0: 1
1: 0
2: 0
3: 9
4: 133
997717756_997717761 -9 Left 997717756 5:136054723-136054745 CCCTCCAATTGATGCCCATACAA 0: 1
1: 0
2: 0
3: 5
4: 95
Right 997717761 5:136054737-136054759 CCCATACAAGGAATTTGCTTCGG 0: 1
1: 0
2: 0
3: 11
4: 104

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997717756 Original CRISPR TTGTATGGGCATCAATTGGA GGG (reversed) Exonic
902135773 1:14303693-14303715 TTGGATAGGCATAAATGGGAAGG - Intergenic
906896999 1:49786039-49786061 TTGTAAAAGCATCAATGGGATGG - Intronic
911006112 1:93226381-93226403 TTGCATTTGAATCAATTGGAAGG + Exonic
911123602 1:94319867-94319889 GAGTATGGGCATGAATAGGAAGG - Intergenic
912079982 1:105923828-105923850 TAGTTTGGGAATCTATTGGAGGG + Intergenic
912635043 1:111284168-111284190 TGGTAGGGGCATCAATTCCATGG - Intergenic
914996311 1:152546160-152546182 TTGTATATGCATCACTTGGTGGG + Intronic
915124515 1:153654313-153654335 TTGTATGTGCAGTAGTTGGATGG + Intergenic
916843009 1:168619515-168619537 TTATCTGGGCAGCCATTGGAGGG + Intergenic
920136521 1:203773684-203773706 CAGTATGGGAATCAATTGGTGGG - Intronic
922766624 1:228159445-228159467 TGGTATGGGCATCAGTTGGTGGG + Exonic
1063098877 10:2932439-2932461 TGGGATGGGAATCAATGGGAGGG + Intergenic
1065078107 10:22101339-22101361 TTGTATGGGCATCAACAAGCAGG + Intergenic
1065395424 10:25231636-25231658 TTATCTGGGCATCAATTAAAAGG + Intronic
1065858897 10:29854013-29854035 TTGCATGGTCCTCAAATGGAAGG + Intergenic
1068638433 10:59374168-59374190 CTGTAAGGCCATCAATTGAATGG - Intergenic
1068770669 10:60817476-60817498 TTGAACGGCCACCAATTGGATGG + Intergenic
1069249107 10:66245918-66245940 TTTTATGGGCCTCAAATGGGAGG + Intronic
1072766693 10:98100274-98100296 TTGTATAAGCATCATTTGCAAGG + Intergenic
1077394043 11:2312488-2312510 TTTTATTAGCATCAATGGGAGGG + Intronic
1086569955 11:88271096-88271118 TTTTTTGAGCATCAATTGAAAGG - Intergenic
1088213234 11:107479651-107479673 TTGTAGGGGTATCAGTGGGAAGG - Intergenic
1104391096 12:128391142-128391164 CTGTATGGCCACCACTTGGAGGG - Intronic
1105439046 13:20400756-20400778 TTGCTAGGGCATAAATTGGAAGG - Intergenic
1109348480 13:61145624-61145646 TTTTATGGGCTTCAGATGGAAGG - Intergenic
1112120168 13:96401299-96401321 TTGTATTGACATCAACTTGAAGG - Intronic
1116205392 14:41858907-41858929 TTGTATGGGAACCATTTGGAAGG - Intronic
1116854659 14:49941432-49941454 TTGTATGTCCATGCATTGGAGGG - Intergenic
1128431517 15:67599638-67599660 TTGCATGGGCAGAAAATGGATGG - Intronic
1128900623 15:71418491-71418513 TTTTATTGACATCAATTGAAAGG + Intronic
1131464012 15:92640116-92640138 TTGTATCAGCATAAATTAGACGG + Intronic
1134035777 16:11030197-11030219 CTGTATGGGCATACATTGTATGG - Intronic
1136385203 16:29920956-29920978 TTGTAGGGGCAGGAACTGGAAGG + Intronic
1139739579 16:69023841-69023863 TTGTATGGCTATCATTTTGATGG - Intronic
1141011922 16:80409500-80409522 TTCTCTGTGCATCATTTGGATGG - Intergenic
1145878489 17:28337251-28337273 TAGTATATGAATCAATTGGAGGG - Intronic
1146516570 17:33494221-33494243 TTGTTTGGGGATCAGTAGGAAGG + Intronic
1146524466 17:33554403-33554425 GTGGATGGGGATCAATTGAAGGG + Intronic
1147764989 17:42828529-42828551 TAGGGTGGGCATCAATTAGAGGG - Intronic
1149583791 17:57770521-57770543 TTGTCTGGATATCAATGGGAAGG + Intergenic
1155545924 18:26914943-26914965 TTGGATGGGAAACATTTGGATGG - Exonic
1155976936 18:32140966-32140988 TTTTATGGCAATCACTTGGATGG - Intronic
1156034037 18:32746950-32746972 GTGTATTAGCATCAACTGGAAGG - Intronic
1157075305 18:44459672-44459694 TTGAATTGGCATCATTTGGGTGG + Intergenic
1164905390 19:31963383-31963405 TTGTATGGAGAACAATTGCAGGG + Intergenic
1167248110 19:48386021-48386043 TTGAATGGGCATCAATTTAATGG - Intronic
1167475671 19:49699630-49699652 TTGTATTGGAATCACCTGGATGG + Intronic
926775350 2:16416820-16416842 TTATAGGGGCATCAATTTGCCGG - Intergenic
926801920 2:16666223-16666245 TTGGCTGGGCATTAATTTGAAGG - Intronic
937268969 2:120635113-120635135 TTGTATGTGCATTAATAGGTTGG - Intergenic
938536964 2:132255593-132255615 TTTAATGAGGATCAATTGGAGGG - Intronic
941409788 2:165140437-165140459 TTGTATGGGAATTACTTGTAAGG - Intronic
941649618 2:168079575-168079597 GTCTATGGGCTTCACTTGGAGGG - Intronic
941760724 2:169239872-169239894 TTGTCTGGGCATCATATTGAAGG - Intronic
945351721 2:208788316-208788338 CTGAATGGGCAAAAATTGGAAGG + Intronic
1170698156 20:18678957-18678979 TTGTCTGGTCATCCATTAGATGG + Intronic
1178276796 21:31246044-31246066 TTGAATGGGCTTCAATCGGACGG - Intronic
1180788495 22:18560142-18560164 AGGGATGGGCATCAAGTGGAAGG + Intergenic
1181233242 22:21435176-21435198 AGGGATGGGCATCAAGTGGAAGG - Intronic
1181245408 22:21499667-21499689 AGGGATGGGCATCAAGTGGAAGG + Intergenic
1185329344 22:50245270-50245292 TTGCATGGGCCTCGATGGGACGG + Exonic
949506515 3:4733369-4733391 ATGTTTAGGCATCAATTTGATGG - Intronic
950373989 3:12555340-12555362 TTTTATGAGCATGAATTGCATGG + Intronic
952442356 3:33344652-33344674 TTACTTGAGCATCAATTGGAAGG + Intronic
952863413 3:37833738-37833760 TTGTAAGGGCATGAAATGAAAGG + Intergenic
955112240 3:55960476-55960498 TTTTTTGGGCATCAAATGCAAGG + Intronic
956364706 3:68487894-68487916 TTTTATTGGCATGTATTGGAGGG + Intronic
957142091 3:76373427-76373449 TTATATGTGCATAATTTGGATGG + Intronic
964664544 3:159157741-159157763 TTGTATGTGCATAAAGTGGAAGG - Intronic
964673255 3:159249973-159249995 TGGTAAGGCCATTAATTGGAAGG + Intronic
966888866 3:184391798-184391820 TTGAATGGGCATTGAATGGATGG - Intronic
975856940 4:78634432-78634454 TTCTGTGGGAATCATTTGGAGGG - Intergenic
977974618 4:103250042-103250064 TTGTAAGGGTATCAGTGGGAAGG - Intergenic
978844361 4:113254193-113254215 TTGGATGGCCATCAATGGAAAGG - Intronic
979395006 4:120177567-120177589 TTGAATGGGCATTAATTTTATGG - Intergenic
980600703 4:135020793-135020815 TTGTAAGTTCATCCATTGGAAGG + Intergenic
989359019 5:40578281-40578303 GTGTATGTGCATGCATTGGACGG + Intergenic
989522718 5:42420577-42420599 TTGAATGGGGAACCATTGGAGGG + Intergenic
990608542 5:57434789-57434811 GTATATGGGCATCATTTAGAGGG - Intergenic
992709979 5:79442570-79442592 TTTTATTGGCATGAAATGGAAGG - Intronic
997717756 5:136054723-136054745 TTGTATGGGCATCAATTGGAGGG - Exonic
998313907 5:141161975-141161997 TTGTTTGTTCATCAATTGGTGGG + Intergenic
1000750300 5:165087153-165087175 TTGTATAGGCTGCAATTGAATGG + Intergenic
1005122031 6:22400708-22400730 CTGTTTGGGCATGCATTGGAGGG + Intergenic
1015444972 6:133293194-133293216 TTATCTGGGCATACATTGGATGG - Intronic
1020556656 7:9679005-9679027 TTGTATGTGCAACTATAGGAAGG + Intergenic
1032924875 7:136591887-136591909 TTGTATGTGCATCAATACAAGGG + Intergenic
1034823310 7:154237036-154237058 TTGTTTGGACCTCAATGGGAAGG - Intronic
1038626919 8:29202973-29202995 TTGTATAGGGTTCAAGTGGATGG - Intronic
1038907854 8:31927226-31927248 TGGAATGGGCATCATTTAGAGGG + Intronic
1041174486 8:55180287-55180309 ATGAATGAGCATAAATTGGATGG + Intronic
1048007465 8:130431136-130431158 TGGCATGGGGATCATTTGGAGGG - Intronic
1054737915 9:68774440-68774462 ATGTATGTACTTCAATTGGAAGG - Intronic
1055566912 9:77578899-77578921 TTGGATGCCCATCAAGTGGAAGG - Intronic
1057014675 9:91641442-91641464 TTTTGGGGGCCTCAATTGGAAGG + Intronic
1060392997 9:123293942-123293964 TAGTATGGTGATCAATTGGTTGG - Intergenic
1061344009 9:130007364-130007386 TTGGATGTGCAACAAATGGAAGG + Intronic
1186124833 X:6401921-6401943 TTGTCTTGGCATCATTTGGCTGG + Intergenic
1192276813 X:69640529-69640551 TTGAGTGGCCCTCAATTGGAGGG + Intronic
1195648468 X:107259767-107259789 TTTCATGGTCATGAATTGGAAGG - Intergenic
1198162304 X:134019693-134019715 TTGAATGGGGATTACTTGGAGGG + Intergenic