ID: 997718564

View in Genome Browser
Species Human (GRCh38)
Location 5:136060146-136060168
Sequence CCACCTACTTAGCTTAAAAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997718561_997718564 -8 Left 997718561 5:136060131-136060153 CCATTTCCAGCTGTTCCACCTAC 0: 1
1: 0
2: 0
3: 24
4: 299
Right 997718564 5:136060146-136060168 CCACCTACTTAGCTTAAAAGAGG No data
997718560_997718564 0 Left 997718560 5:136060123-136060145 CCTGTCTTCCATTTCCAGCTGTT 0: 1
1: 0
2: 3
3: 62
4: 341
Right 997718564 5:136060146-136060168 CCACCTACTTAGCTTAAAAGAGG No data
997718559_997718564 13 Left 997718559 5:136060110-136060132 CCAGAGCAGGAAGCCTGTCTTCC 0: 1
1: 0
2: 2
3: 19
4: 231
Right 997718564 5:136060146-136060168 CCACCTACTTAGCTTAAAAGAGG No data
997718558_997718564 14 Left 997718558 5:136060109-136060131 CCCAGAGCAGGAAGCCTGTCTTC 0: 1
1: 0
2: 0
3: 36
4: 285
Right 997718564 5:136060146-136060168 CCACCTACTTAGCTTAAAAGAGG No data
997718557_997718564 21 Left 997718557 5:136060102-136060124 CCTTTTGCCCAGAGCAGGAAGCC 0: 1
1: 0
2: 0
3: 31
4: 292
Right 997718564 5:136060146-136060168 CCACCTACTTAGCTTAAAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997718564 Original CRISPR CCACCTACTTAGCTTAAAAG AGG Intronic
No off target data available for this crispr