ID: 997722394

View in Genome Browser
Species Human (GRCh38)
Location 5:136089635-136089657
Sequence TTGGAGGAACGGCCTAATGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997722394_997722400 20 Left 997722394 5:136089635-136089657 CCTTCATTAGGCCGTTCCTCCAA No data
Right 997722400 5:136089678-136089700 AATACATTTTCTGAATTTGGTGG No data
997722394_997722399 17 Left 997722394 5:136089635-136089657 CCTTCATTAGGCCGTTCCTCCAA No data
Right 997722399 5:136089675-136089697 CCTAATACATTTTCTGAATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997722394 Original CRISPR TTGGAGGAACGGCCTAATGA AGG (reversed) Intergenic
No off target data available for this crispr