ID: 997723462

View in Genome Browser
Species Human (GRCh38)
Location 5:136100008-136100030
Sequence GAGTCTGTCAAATGGGAGGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997723462_997723472 21 Left 997723462 5:136100008-136100030 CCCCCCTCCCATTTGACAGACTC No data
Right 997723472 5:136100052-136100074 TATTACCTTCACTTCCTCCTGGG No data
997723462_997723471 20 Left 997723462 5:136100008-136100030 CCCCCCTCCCATTTGACAGACTC No data
Right 997723471 5:136100051-136100073 GTATTACCTTCACTTCCTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997723462 Original CRISPR GAGTCTGTCAAATGGGAGGG GGG (reversed) Intergenic
No off target data available for this crispr